Overview

Comprehensive Description

Biology

In the Red Sea, it is often found on patchy open reef areas. Feeds diurnally on fishes (64%, mostly pomacentrids) and crustaceans (36%). It is a monogamous species, the pair jointly defends a common territory of up to 62 square m (Ref. 6480). Major threats include overfishing, lack of management and habitat loss (Ref. 089707).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: only from the northern end of the Red Sea to the Persian Gulf and coast of Pakistan. Records from elsewhere are apparently based on misidentifications of other species. Misidentified as Cephalopholis miniatus by Kuronuma & Abe (1986, Ref. 5999) from Kuwait.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Northwestern Indian Ocean: Gulf of Aden and Persian Gulf (Arabian Gulf) to Pakistan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 8 - 10; Analspines: 3; Analsoft rays: 8 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

35.0 cm TL (male/unsexed; (Ref. 5222)); max. reported age: 26 years (Ref. 1784)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

distinguished by the following characteristics: body depth 2.7-3.0 in SL; head length 2.4-2.6 in SL; flat interorbital area; rounded preopercle, finely serrate, lower edge fleshy; distinctly convex upper edge of operculum; scaly maxilla, reaching to or somewhat beyond vertical at rear edge of eye; ctenoid body scales, without auxiliary scales (Ref. 089707).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 3 - 12

Graphical representation

Depth range (m): 3 - 12
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 4 - 55 m (Ref. 5222), usually 15 - 20 m (Ref. 89707)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 3 - 12

Graphical representation

Depth range (m): 3 - 12
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 55m.
From 4 to 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

More often occurs on patchy open reef areas rather than on well developed coral reefs in the Red Sea. An ambush predator which feeds throughout the day (Ref. 5222). Also in Ref. 9137.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalopholis hemistiktos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGAACAGCACTCAGCCTATTAATCCGGGCGGAACTAAGCCAACCAGGTGCTTTACTCGGCGATGATCAAATCTATAACGTAATTGTTACAGCACATGCTTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGTGGATTCGGAAACTGACTTATTCCACTAATGATCGGTGCCCCCGATATAGCATTCCCCCGAATGAATAATATGAGCTTCTGGCTCCTTCCCCCATCATTTCTGCTTCTGCTAGCCTCCTCTGGGGTAGAAGCTGGTGCTGGGACTGGTTGAACGGTATATCCGCCCTTAGCCGGTAACCTAGCCCACGCAGGTGCCTCTGTTGATCTTACTATCTTTTCTCTTCATTTAGCAGGAATTTCATCAATTCTAGGAGCTATTAACTTCATTACTACCATTATTAACATAAAACCCCCTGCCATCTCCCAATACCAAACACCACTATTTGTCTGAGCTGTGCTAATTACAGCCGTTCTTCTTCTCCTCTCTCTTCCTGTCCTTGCTGCTGGTATTACAATGCTTCTAACAGACCGAAATCTTAACACCACTTTCTTCGACCCTGCTGGCGGAGGAGACCCAATCCTTTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalopholis hemistiktos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!