Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur on deep reef slopes rich with invertebrates such as sponges and seawhips, but young adults are occasionally seen much shallower (Ref. 48636). Usually solitary in coral and rocky reefs. Feed mainly on benthic, hard-shelled, invertebrates such as mollusks and crustaceans. Protogynous (Ref. 55080). Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: east coast of Africa to Japan, the Philippines and New Caledonia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Philippines, north to Ryukyu Islands, south to Houtman Abrolhos (Western Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 550 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

55.0 cm TL (male/unsexed; (Ref. 4392)); max. published weight: 1,812 g (Ref. 4887)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Usually solitary in coral and rocky reefs. Feeds mainly on benthic, hard-shelled, invertebrates such as molluscs and crustaceans.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Young easily identified by the unusual coloration. Adults normally have an oval shaped black saddle near the tail, but it may become indistinct in large males (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 9 specimens in 2 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 6.5 - 40
  Temperature range (°C): 25.104 - 26.262
  Nitrate (umol/L): 0.006 - 0.397
  Salinity (PPS): 34.930 - 35.248
  Oxygen (ml/l): 4.698 - 4.799
  Phosphate (umol/l): 0.088 - 0.114
  Silicate (umol/l): 1.304 - 1.566

Graphical representation

Depth range (m): 6.5 - 40

Temperature range (°C): 25.104 - 26.262

Nitrate (umol/L): 0.006 - 0.397

Salinity (PPS): 34.930 - 35.248

Oxygen (ml/l): 4.698 - 4.799

Phosphate (umol/l): 0.088 - 0.114

Silicate (umol/l): 1.304 - 1.566
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 160 m (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 2 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 6.5 - 40
  Temperature range (°C): 25.104 - 26.262
  Nitrate (umol/L): 0.006 - 0.397
  Salinity (PPS): 34.930 - 35.248
  Oxygen (ml/l): 4.698 - 4.799
  Phosphate (umol/l): 0.088 - 0.114
  Silicate (umol/l): 1.304 - 1.566

Graphical representation

Depth range (m): 6.5 - 40

Temperature range (°C): 25.104 - 26.262

Nitrate (umol/L): 0.006 - 0.397

Salinity (PPS): 34.930 - 35.248

Oxygen (ml/l): 4.698 - 4.799

Phosphate (umol/l): 0.088 - 0.114

Silicate (umol/l): 1.304 - 1.566
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 8 - 160m.
From 8 to 160 meters.

Habitat: reef-associated. Bodianus bilunulatus = Saddleback hogfish.  (Lacepede, 1801)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Size at sex change: 38.6-40.5 cm L (Ref. 55080).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bodianus bilunulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACCGCGCTAAGTTTACTTATCCGGGCCGAACTAAGCCAACCCGGTGCTCTCCTCGGAGACGACCAGATTTATAATGTTATCGTTACGGCACACGCCTTCGTAATAATCTTCTTTATAGTAATACCCATTATGATTGGAGGTTTTGGAAACTGACTTATCCCTCTAATAATTGGGGCCCCCGACATGGCATTTCCTCGAATGAACAACATGAGCTTCTGACTCCTCCCTCCATCTTTCCTACTGCTGTTAGCCTCTTCAGGCGTAGAAGCAGGAGCTGGCACCGGATGGACCGTTTATCCGCCCCTAGCAGGCAATCTAGCCCATGCAGGAGCATCCGTCGACTTAACCATCTTCTCCCTTCACCTAGCTGGGGTCTCCTCAATTTTAGGTGCAATTAACTTTATCACCACAATTATTAACATGAAACCACCAGCCATCTCTCAATACCAAACCCCTCTCTTTGTTTGAGCCGTCCTAATTACCGCTGTACTACTTCTGCTCTCTCTCCCCGTCCTGGCCGCCGGCATTACAATGCTATTAACAGACCGAAACCTAAATACTACATTCTTTGACCCAGCCGGCGGAGGGGACCCGATTCTATACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bodianus bilunulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 60 specimens with morphological vouchers housed at National Institute of Water and Atmospheric Research, Auckland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bodianus bilunulatus

The Tarry hogfish, Bodianus bilunulatus, is a species of wrasse native to the Indian Ocean from the African coast to the western Pacific Ocean to Japan, New Caledonia, and the Philippines. Reports of its presence in Hawaii are erroneous. This species occurs on reef slopes at depths of from 3 to 160 m (9.8 to 524.9 ft) with the adults being found in deeper waters than the juveniles. This species can reach 55 cm (22 in) in total length with a maximum recorded weight of 1.8 kg (4.0 lb). It is of minor importance to local commercial fisheries and is also popular as a game fish. It can also be found in the aquarium trade.[2] Other common names include: blackspot wrasse, crescent-banded hogfish, Hawaiian hogfish, saddle-back hogfish, table boss, and tuxedo hogfish.

References[edit]

  1. ^ Russell, B. 2010. Bodianus bilunulatus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 01 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2008). "Bodianus bilunulatus" in FishBase. December 2008 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!