Overview

Comprehensive Description

Biology

Adults inhabit coral-rich areas of sheltered lagoon and inshore coral reefs (Ref. 9710). They occur in small groups on Acropora patches (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: including Solomon Islands, northern Papua New Guinea, Philippines, and Ryukyu Islands. There is a doubtful record from the Great Barrier Reef off Cairns, Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indonesia, Sabah and Philippines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 10 - 12; Analspines: 2; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 70 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Head and body blue with yellow posterior zone extending to caudal fin. Body depth 1.9-2.2 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 16 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 16m.
From 1 to 16 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral-rich areas of sheltered lagoon and inshore coral reefs (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysiptera parasema

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAGTATTCGGTGCCTGAGCTGGGATAGTAGGTACAGCCTTAAGCCTTCTCATCCGAGCAGAACTAAGCCAACCAGGCGCGCTCCTAGGAGACGACCAAATCTATAACGTCATCGTTACCGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTTTGATTGGAGGCTTTGGAAACTGATTAATTCCACTAATGCTGGGAGCTCCCGATATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTACTGCCCCCATCCTTCCTTCTTCTGCTTGCCTCTTCTGGGGTCGAAGCTGGGGCCGGCACAGGTTGGACTGTTTACCCCCCACTATCCGGCAACCTCGCCCATGCAGGTGCATCCGTAGACTTAACCATCTTCTCGCTTCATCTAGCAGGCATTTCATCAATTTTAGGAGCCATTAATTTTATTACAACCATCATTAACATAAAACCTCCTGCCATCTCACAATACCAAACCCCCTTATTTGTATGAGCAGTCCTAATTACTGCTGTTCTTCTTCTCCTTTCTCTGCCAGTATTGGCCGCTGGAATTACCATACTTCTAACCGACCGAAACCTTAACACCACCTTCTTCGACCCCGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrysiptera parasema

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chrysiptera parasema

Chrysiptera parasema, also known as Yellowtail Damselfish or Goldtail demoiselle is a popular saltwater aquarium fish from the Indo-Pacific.

Appearance[edit]

A small marine fish that reaches three inches in length. It is blue with a yellow tail.

In the Aquarium[edit]

Chrysiptera parasema is a hardy member of a saltwater aquarium. Because of this and its usually low price it is often recommended as a way for novice marine aquarium keepers to gain experience. Thirty gallons is typically quoted as the minimum tank size required to permanently house this fish.

It is less aggressive than most damselfish but will sometimes harass more passive fish. Despite its comparatively peaceful nature it can be territorial with members of its own species. This aggression can sometimes be reduced by keeping them in groups of three to seven. They do show schooling behavior when kept in large groups.[1] Despite its hardy nature, it also must not be placed in an aquarium with larger predatory fish such as lionfish[citation needed], and grouper which will often see it as a food source.

References[edit]

  1. ^ http://www.centralpets.com/animals/fish/saltwater_fish/swf2087.html


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!