Overview

Brief Summary

Myliobatis californica, commonly known as bat rays, are typically found in sandy and muddy bays and estuaries, rock reefs and kelp beds from southern Oregon to the Gulf of California (Hopkins 1993). They have a flat and triangular shape (Martin and Cailliet 1988), with a whip-like tail and venomous spines (up to 2 or 3) at its base. These animals regularly feed on flat muddy bottom animals like clams and echiuroid worms (Talent 1982). The bat ray has been found in depths reaching 354 ft (107 m). The largest bat ray on record weighed 240 pounds (108 kg). They can reach up to a width of six feet (Love 2011), and can live to be at least 23 years of age (Martin and Cailliet 1988). Bat rays are generally solitary animals, except for when they are found together during feeding and mating (Martin and Cailliet 1988, Hopkins 1993). Adult bat rays reproduce annually, with a mating season in the spring and summer months (Martin and Cailliet 1988).

References:

Hopkins, T. 1993. The Physiological Ecology of Bat Rays, Myliobatis californica, in Tomales Bay, California. PhD Dissertation, University of California, Davis. Pp 11-80

Love, M. S. 2011. Certainly more than you want to know about the fishes of the Pacific Coast. Really Big Press, Santa Barbara, California.

Martin, L. K., and G.M. Calliet. 1988. Aspects of the Reproduction of the Bat Ray, Myliobatis california, in Central California. Copeia. No. 3: 754-761.

Talent, L.G. 1982. Food habits of gray smoothhound, Mustelus californicus, the brown smoothhound, Mustelus henlei, the shovelnose guitarfish, Rhinobatos productus, and the bay ray, Myliobatus californica, in Elkhorn Slough, California. Calififornia Fish and Game 68:224-234

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: bat ray (English), bat-eagle ray (English), tecolote (Espanol)
 
Myliobatis californica Gill, 1865

California bat ray,     California bat-eagle ray

Disc rhomboidal, wider than long; head and snout blunt, rounded, raised, projecting well before disc; pectorals bluntly pointed, concave at rear, continue onto rostrum; teeth in flat, pavement-like plates, with 7 series of plates, upper plates not arched; eyes and spiracles on side of head; tail slender, about as long as disc, no tail fin; 1 large spine at base of tail after small dorsal fin.

Similar to  M. peruvianus but is larger, has blunter pectoral tips and the dorsal fin origin in further forward, nearer the pelvic fins (1x rather than 2x the length of the dorsal fin base after of the pelvic fin base).

Olive to dark brown to black above, white below.

Size: 180 cm wide.

Habitat: sand, mud and rocky bottoms, and algal beds.

Depth: 1-108 m.

Oregon to the Gulf of California.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Commonly found in sandy and muddy bays and sloughs, also on rocky bottom and in kelp beds (Ref. 2850). Sometimes buries itself in sand (Ref. 2850). Found singly or in schools (Ref. 12951). Feeds on bivalves, snails, polychaetes, shrimps, and crabs (Ref. 9257). Ovoviviparous (Ref. 50449). Venomous spine on tail. Not fished commercially, but shows up as by-catch species (Ref. 9257).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Bat Ray occurs from Oregon, United States, to Baja California, Mxico (including the Gulf of California) in the eastern Pacific Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 108 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bat rays are found in shallow waters and coral reefs from Oregon to the Sea of Cortez.

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Oregon, USA to Gulf of California (Ref. 2850) and the Galapagos Islands (Ref. 28023).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 180.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bat rays are commonly distinguished from other rays because of their distinct, protruding head and large eyes (  a close look). They have a flat body with a dorsal fin at the base of the tail. The tail is whiplike and can be as long or longer than the width of the body. It is armed with a barbed stinger that is venomous. Bat rays are named for their two long pectoral fins that are shaped like the wings of a bat. The skin is smooth, dark brown or black and has no markings. Bat rays have a white underbelly. The skeleton is made of cartilage, instead of bone. Bat rays are usually born measuring 11.4 inches and can grow to reach 5.9 feet. Females are typically larger than males and have been found weighing up to 200 pounds. (  Details.)

Range mass: 0 to 0 kg.

Other Physical Features: bilateral symmetry

  • Michael, S. 1993. Reef Sharks & Rays of the World: A guide to their identification, behavior, and ecology.. Monterey, California: Sea Challengers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1800 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

180 cm WD (male/unsexed; (Ref. 2850)); max. published weight: 82.1 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Bat Ray is commonly found in shallow bays and have been reported from intertidal zones to 108 m but are more common in shallower waters (Morris et al. 1996). In southern California, this species occurs along the open coast and around islands where it frequents kelp beds and sandy bottoms near rocky reefs and sandy beaches.

In San Francisco Bay and Elkhorn Slough in Monterey County California, parturition appears to occur from March through June, with a peak in April and May. It also reportedly occurs at approximately the same time in other bays (Humboldt, Tomales, Morro, Santa Monica and San Pedro Bay) in California (Talent 1985, Martin and Cailliet 1988a). Bays and sloughs appear to be important nursery areas. Females are also thought to release their pups along more open coastal areas in southern California, and have been observed giving birth to young in water 1m in depth over a shallow flat in Catalina Harbour. Newly born pups are reportedly found in northern California sloughs in April and May; also in the shallow surf zone in more southerly areas such as Santa Monica Bay in southern California around late May and June (Talent 1985, Martin and Cailliet 1988a, Monaco et al. 1990). In Estero de Punta Banda along the northern portion of the Baja California peninsula, Bat Ray abundance increases from October to a maximum in January and become uncommon in the spring and summer months (Beltrn-Flix et al. 1986). Peak abundance of Bay Ray in Baha Almejas, Mxico along the southern portion of the Pacific Baja California peninsula occurs in March and consists primarily of adults (Villavicencio-Garayzar 1995, 1996). Both locations appear to serve as pupping and reproductive grounds for this ray.

The reproductive mode of Bay Ray is histotrophy (Hamlett 2005). Females produce up to 12 offspring (more commonly smaller litter sizes) in an annual reproductive cycle, with gestation lasting nine to twelve months (Baxter 1980, Martin and Cailliet 1988a). The pups are born at 22-35.6 cm disc width (DW) (Baxter 1980, Martin and Cailliet 1988a). Females reach a larger size and age and have a growth coefficient (k) in the von Bertalanffy growth equation of 0.0995, reaching asymptotic size (159 cm DW) in 24 years (Martin and Cailliet 1988b). Age at 50% maturity for females has been observed by Martin and Cailliet (1988a) to be 5 years, at 88.1 cm DW. Males reportedly first mature at around 2-3 years of age, and size at 50% maturity occurs between 45 and 62.2 cm DW (Martin and Cailliet 1998a,b). In southern Baja California, Mxico, these rays apparently mature at smaller size than reported from California with males attaining maturity between 40 and 50 cm DW and females <70 cm DW have been found to be immature (Villavicencio-Garayzar 1995, 1996), however limited biological information on the species from this region is available. Maximum size is 180 cm DW (Eschmeyer et al. 1983).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 15
  Temperature range (°C): 19.804 - 21.311
  Nitrate (umol/L): 0.144 - 0.860
  Salinity (PPS): 34.213 - 34.246
  Oxygen (ml/l): 5.074 - 5.165
  Phosphate (umol/l): 0.352 - 0.521
  Silicate (umol/l): 3.264 - 4.304

Graphical representation

Depth range (m): 0 - 15

Temperature range (°C): 19.804 - 21.311

Nitrate (umol/L): 0.144 - 0.860

Salinity (PPS): 34.213 - 34.246

Oxygen (ml/l): 5.074 - 5.165

Phosphate (umol/l): 0.352 - 0.521

Silicate (umol/l): 3.264 - 4.304
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Rocks, Macroalgae, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bat rays   are found living close to the shores of bays, sloughs, kelp beds and coral reefs. Bat rays prefer to live in areas with sandy or muddy bottoms for it allows easier access to food. They are most commonly found in depths reaching between 3m and 12m but have occasionally been spotted as deep as 46m.

Aquatic Biomes: reef ; coastal

  • Gray, A., T. Mulligan, R. Hannah. 1997. Food habits, occurence, and population structure of the bat ray, Myliobatis Californica, in Humboldt Bay, California. Environmental Biology of Fishes, 49: 227-238.
  • Last, P., J. Stevens. 1994. Sharks and Rays of Australia. Australia: CSIRO.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bat rays, Myliobatis californica, forage in shallow mudflats and seagrass beds in coastal waters ranging from central Oregon to the Gulf of California (Miller and Lea 1972, Gray et al. 1997). As large, benthic predators, they can alter benthic habitats and the associated invertebrate populations through their feeding habit of creating pits in soft sediments up to 4m long and 20cm deep. Bat rays typically migrate into bays and estuaries during the spring and summer months to reproduce (Gray et al. 1997).

References:

Gray, A.E., T.J. Mulligan and R.W. Hannah. 1997. Food habits, occurrence, and population structure of the bat ray, Myliobatis californica, in Humboldt Bay, California. In Environmental Biology of Fishes. Kluwer Academic Publishers, Netherlands. 49:227-23

Hopkins, T. 1993. The Physiological Ecology of Bat Rays, Myliobatis californica, in Tomales Bay, California. PhD Dissertation, University of California, Davis. Pp 11-80

Miller, D.J. and R.N. Lea. 1972. Guide to the coastal marine fishes of California. Calif. Dept. Fish Game, Fish Bull. 157:1-249

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 46 m (Ref. 12951)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 15
  Temperature range (°C): 19.804 - 21.311
  Nitrate (umol/L): 0.144 - 0.860
  Salinity (PPS): 34.213 - 34.246
  Oxygen (ml/l): 5.074 - 5.165
  Phosphate (umol/l): 0.352 - 0.521
  Silicate (umol/l): 3.264 - 4.304

Graphical representation

Depth range (m): 0 - 15

Temperature range (°C): 19.804 - 21.311

Nitrate (umol/L): 0.144 - 0.860

Salinity (PPS): 34.213 - 34.246

Oxygen (ml/l): 5.074 - 5.165

Phosphate (umol/l): 0.352 - 0.521

Silicate (umol/l): 3.264 - 4.304
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 46m.
From 1 to 46 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Some bat rays, Myliobatis californica, follow an annual migration pattern, returning to important nursery areas in California, such as Elkhorn Slough, Tomales Bay, and Humboldt Bay during the spring and summer months to mate and reproduce (Martin and Calliet 1988, Gray et al. 1997, Matern et. al 2000). They then typically leave these habitats when the temperatures drop below 10°C (Gray et al. 1997). It has also been suggested based on movement patterns through different water temperatures that Myliobatis californica use behavioral thermoregulation (Matern et. al 2000).

References:

Gray, A.E., T.J. Mulligan and R.W. Hannah. 1997. Food habits, occurrence, and population structure of the bat ray, Myliobatis californica, in Humboldt Bay, California. In Environmental Biology of Fishes. Kluwer Academic Publishers, Netherlands. 49:227-23

Hopkins, Todd. 1993. The Physiological Ecology of Bat Rays, Myliobatis californica, in Tomales Bay, California. PhD Dissertation, University of California, Davis. Pp. 11-80

Martin, L.K., and G.M. Calliet. 1988. Aspects of the Reproduction of the Bat Ray, Myliobatis california, in Central California. Copeia. No. 3: 754-761.

Matern, S.A., J J. Cech and T.E. Hopkins. 2000. Diel movements of bat rays, Myliobatis california, in Tomales Bay, California: evidence for behavioral thermoregulation? Environmental Biology of Fishes, 58: 171-180.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bat rays are carnivorous and feed on a variety of molluscs, crustaceans, and small fishes. Diet varies with the abundance of prey locally. Juveniles eat primarily clams and shrimp. Adult bat rays eat larger prey, including larger clams, crabs, shrimp, and echiuran worms.

Bat rays use their snout to dig invertebrates from the sand, making bat rays an important benthic predator. They also capture prey by lifting the body on the pectoral fin tip, flapping the pectoral tips quickly up and down, and then using the suction created by the flapping to pull sand out from under the body, exposing hidden prey. When bat rays feed on molluscs, they eat the entire animal, crush the shell inside of the mouth, spit out the hard shell pieces, and then eat the soft part of the mollusc body. Bat rays, depending on size, may burrow with their nose deeper into the sand or mud bottoms in an effort to eat larger prey.

Animal Foods: mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

  • Talent, L. 1982. Food Habits of the Gray Smoothhound, Mustelus Californicus, the Brown Smoothhound, Mustelus Henlei, the Shovelnose Guitarfish, Rhinobatos Productus, and the Bat Ray, Myliobatis Californicus, in Elkhorn Slough, California. California Fish and Game, 68: 224-234.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Also in Ref. 9137.
  • Talent, L.G. 1982 Food habits of the gray smoothhound, Mustelus californicus, the brown smoothhound, Mustelus henlei, the shovelnose guitarfish, Rhinobatos productus, and the bat ray, Myliobatis californica, in Elkhorn Slough, California. Calif. Fish Game 68(4):224-234.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myliobatic californica (bat ray) dietary habits change with the size of the animal. As bat rays grow, the prey they feed on also increase in size. Smaller bat rays tend to eat more clams. In contrast, larger bat rays, typically greater than 80cm, eat more echiuroid worms. Polychaetes, crabs (cancer and bay crabs), shrimp, sea cucumbers and brittle stars are also consumed by bat rays, but make up a small portion of their diet. Bat rays have been observed to capture prey that are burrowed into soft sediments by actively digging, often creating pits up to 4m long and 20cm deep (Talent 1982, Gray et al. 1997).

References:

Gray, A.E., T.J. Mulligan and R.W. Hannah. 1997. Food habits, occurrence, and population structure of the bat ray,Myliobatis californica, in Humboldt Bay, California. Environmental Biology of Fishes. Kluwer Academic Publishers, Netherlands. 49:227-238

Talent, L.G. 1982. Food habits of gray smoothhound, Mustelus californicus, the brown smoothhound, Mustelus henlei, the shovelnose guitarfish, Rhinobatos productus, and the bay ray, Myliobatus californica, in Elkhorn Slough, California. California Fish and Game, 68:224-234

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators of the bat ray are California sea lions and broadnose sevengill sharks.

Known Predators:

  • California sea lions (Zalophus californianus)
  • broadnose sevengill sharks (Notorynchus cepedianus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Bat rays have been known to live up to 23 years.

Range lifespan

Status: wild:
23 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva, No pelagic phase
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bat rays reproduce on an annual cycle, usually copulating during the spring or summer of one year and then giving birth the following spring or summer. The male chooses his mate by following close behind her and assessing her reproductive condition by smelling her chemical signals. When the male has found a suitable mate, he continues to swim close behind and moves under so that his back is touching her stomach. He rotates a clasper up and to the side of the female. After inserting it into her cloaca, they swim together with synchronous beats of the pectoral fins. Many times, males will fight over a particular female. The female may end up having more than one male clinging onto her pectoral fins at one time and will wait for one of the males to finally flip her into the correct position. Bat rays reproduce in large mating aggregations with the females clustering in one area. Females may lie on top of one another, burying females that have already mated or those that are not sexually mature yet. This allows less confusion for the males to pick a suitable mate.

The gestation period is between 8-12 months and the number of live young born depends upon the size of the mother but can be up to 10 pups at a time. The female enters a bay area to deliver in an effort to protect from larger predators in the ocean and to allow access to a more stable food source. The young pups do not require any parental care and are born with stingers ready to protect from predators. Before bat rays are actually born, the stinger is pliable and has a sheath that is sloughed. It protects the mother from the dangerous stinger during delivery but is immediately lost at the time of delivery. Bat rays reach sexual maturity around the age of 5 years, usually when they measure from wing tip to wing tip 67-68 cm.

  • Last, P., J. Stevens. 1994. Sharks and Rays of Australia. Australia: CSIRO.
  • Michael, S. 1993. Reef Sharks & Rays of the World: A guide to their identification, behavior, and ecology.. Monterey, California: Sea Challengers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The gestation period of Myliobatis californica (bat rays) has been found to last between 9 months to a full year, with females carrying between 2-12 embryos (as cited in Martin et al. 1988). Bat rays have an annual reproduction cycle. There are an increase in juvenile bat rays found in the spring and summer months. Male bat rays reach sexual maturity at 2-3 years of age, while females reach maturity at approximately 5 years of age. A distinct annual reproductive pattern is suggested by reproductive behaviors, ovulating females and full-term fetuses all being observed during the summer months (Martin et al. 1988).

References:

Martin, L.K., and G.M. Calliet. 1988. Aspects of the Reproduction of the Bat Ray, Myliobatis california, in Central California. Copeia. No. 3: 754-761.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myliobatis californica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTGATCTTTGGTGCATGAGCAGGGATAGTGGGTACTGGCCTCAGCCTACTAATTCGAACAGAACTAAGTCAACCAGGGGCCTTGTTGGGTGACGACCAAATTTATAATGTGATCGTTACCGCCCATGCCTTTGTAATAATTTTCTTCATGGTCATACCAATCATGATCGGTGGTTTCGGTAATTGATTAGTCCCCTTGATGATCGGTGCCCCAGACATAGCCTTCCCACGAATAAATAATATAAGTTTCTGACTTCTACCCCCATCTTTTCTTCTACTACTAGCCTCAGCAGGAGTAGAGGCCGGGGCTGGTACTGGGTGAACTGTTTATCCCCCTCTAGCTGGCAACCTAGCACATGCTGGGGCCTCTGTAGATTTAACTATCTTTTCCCTACATCTAGCAGGGGTTTCCTCTATTCTGGCATCAATCAATTTTATCACCACAATTATTAACATAAAACCACCCGCAATTTCTCAATACCAAACACCCCTCTTTGTCTGATCTATTCTTATTACAACCATTCTTCTCTTATTGTCCCTGCCCGTTCTGGCAGCAGGCATCACCATGCTCCTCACAGATCGTAATCTTAATACAACCTTCTTCGACCCTGCAGGGGGTGGTGACCCCATTCTTTACCAACATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myliobatis californica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
van Hees, K., Pien, C., Ebert, D.A., Cailliet, G.M. & Smith, W.D.

Reviewer/s
Machura, B. & Lawson, J.

Contributor/s

Justification
Bat Ray (Myliobatis californicus) occurs from Oregon, United States, to Baja California, Mxico (including the Gulf of California) in the eastern Pacific Ocean. This eastern Pacific coastal ray is relatively fast-growing, reaching maturity at around 2-3 years for males and five years for females. It produces up to 12 pups per year although smaller litter sizes are more common.

Bat Ray is caught in artisanal multi-species elasmobranch fisheries in Mxico, is obtained as bycatch in demersal trawls, longlines, and gillnets in the United States and Mxico, is caught in recreational fisheries in the United States, and was historically targeted in the United States. There are no reliable population estimates, however this species has been recorded in artisanal elasmobranch fishery surveys in the Gulf of Mexico and in species-specific landings in California. In artisanal elasmobranch fisheries, this species was relatively common in catches along the mainland coast of Mexico (Sorona), and much less common in catches from the Baja peninsula. Commercial bycatch landings of this species have generally increased from 2001-2014, and recreational fishing surveys suggested that population abundance increased from the 1950s to the 1990s, which has been reinforced by recent fisheries-independent surveys from 2013 to 2014. Additionally, fisheries in California that historically targeted this species as a nuisance, ceased in 1994.

Given the fast growth and early maturity of this species, as well as patterns that suggest an increase in abundance in Californian waters, and commonality in catches along the mainland coast of Mexico, this species is considered to be Least Concern. However, it is unknown if the rarity of this species in the Baja peninsula suggest natural low abundance or is a result of overfishing, so overall population trend remains unknown. Improved recording and monitoring of landings in Mexican artisanal and industrial fisheries are needed.

History
  • 2006
    Least Concern (LC)
  • 2000
    Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Listed, Least concern

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bat rays were once persecuted in parts of coastal California because they were thought to prey on cultivated oysters. Bat rays were routinely killed in their nursery grounds, devastating local populations.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information on the population size or subpopulations is available for this species. However, the Pacific coast and Gulf of California stocks may be disjunct subpopulations as there are few taken in the southern Gulf of California (C. Villavicencio-Garayzar pers. comm.). The highest abundances in estuaries along the Pacific coast appear to be Elkhorn Slough and San Francisco, Tomales, Humboldt, Morro, Santa Monica, and San Pedro Bays in California (Talent 1985, Gray et al. 1997, Ebert 2003). Other California bays such as Drakes Estero in northern California, and Alamitos, Anaheim, Newport, Mission, and San Diego Bays in southern California are also frequented by this species (Monaco et al. 1990). In Mxico, these rays are often observed and captured on the Pacific coast of Baja and the northern Gulf of California, but are uncommon in the southern Gulf of California.

A survey of artisanal fishers targeting elasmobranchs in the Gulf of California covered landing sites in both Baja California and the Mexican mainland (Sonora). This survey found that Bat Ray comprised 5.6% of the chondrichthyan landings in 1998-1999, and was considered one of the five most prominent taxa found in landings in 1999 (accounting for 3.0%). Only three species accounted for >5% of the catch in either year, so these landings are significant. Bat Ray specimens that were examined were mostly immature, females comprised the largest size classes and were of larger mean sizes than males, and the overall landed sex ratio was male-biased (Bizzarro et al. 2007). When broken down by region, Bat Ray was one of five taxa that accounted for the greatest proportion of the ray landings along Sonora, Mexico (1.2% of the total catch; Bizzarro et al. 2009a), and comprised a much smaller proportion of the total chondrichthyan catch on Baja California (only 0.3% of the total catch, and were only encountered in autumn and winter; Bizzarro et al. 2009). On the Pacific side of Baja California, fishery surveys in the Baha Magdalena lagoon complex (Villavicencio-Garyazar 1995, Bizzarro and Smith unpublished data) indicate that this species is not a common component of artisanal landings. No other information is available on the species' contribution to bycatch in other artisanal or trawl fisheries, but they are known to be taken in shrimp trawls.

Commercial bycatch of skates and rays in California reference Bat Ray as one of the four most common taxa in these landings, although not all caught skates and rays are identified to species (Leet et al. 2001). A report on the status of skate and ray populations in California, noted that while landings underwent an increase from 103 metric tons (mt) in 1989 to 868 mt in 1999, this does not necessarily reflect an increase in abundance (Leet et al. 2001). In species-specific commercial landings data in California, Bat Ray landings increased between 2001 (0.09 mt) and 2012 (6.93 mt). The past two years (2012 and 2013) recorded much lower landings of 2.84 and 3.38 mt, respectively (California Department of Fish and Wildlife).

In Humboldt Bay, California, Bat Ray were persecuted because of perceived predation on commercial oyster beds. This activity was taken under permit by the oyster company and an annual average of over 1,100 individuals were caught, with a total reported catch of 42,996 rays from 1956 to 1992 (Gray 1994, Gray et al. 1997). Bat Ray were captured by trawl, longline, and trap, however, information on fishing effort is not available. Furthermore, there are no details of population size that would allow the detection of changes in density as a result of this removal policy, and so the localized affect of this practice is unknown. Gray (1994) demonstrated that predation by bat rays in oyster beds was in fact rare which later prompted a change in the oyster company permit and extermination effectively ceased. Ironically, Bat Ray fed extensively on red rock crabs, a major oyster predator (Gray 1994, Gray et al. 1997).

Carlisle et al. (2008) analysed recreational fishing derby data from 1951 to 1995 in Elkhorn Slough, California. Derbies were held in the summer, in an attempt to control shark and ray populations that were suspected of reducing shellfish and finfish populations in the slough. Of the total catch of all the derbies analysed, Bat Ray were the most abundant species, with a total of 3,310 (55.6%) individuals caught. Although fishing effort in these derbies increased through the decades, the average number of bat rays landed per derby decreased slightly from 63 in the 1950s to 50 in the 1990s. However, the relative abundance of bat rays steadily increased from 47% in the 1950s to 68% in the 1990s. As the other species in the slough saw declines in relative abundance, these data suggest that Bat Ray may not be as susceptible to fishing pressure. Additionally, Bat Ray age, size and sex structure remained stable throughout the derbies, indicating fishing pressure did not dramatically impact the population. The derbies concluded in 1995, and fishing pressure on this species was greatly reduced in this area. Gill net fishing for sharks and rays in Elkhorn Slough was conducted from 20132014 by a student at Moss Landing Marine Laboratories. Although fishing was conducted with a different gear type at a different location in the slough, Bat Ray, especially immature individuals, were the most abundant comprising 62.3% of the catch (van Hees, 2014, unpublished data).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Bat Ray is caught in artisanal multi-species elasmobranch fisheries in Mxico, is also obtained as bycatch in demersal trawls, longlines, and gillnets in the United States and Mxico, is caught in recreational fisheries in the United States, and was historically targeted in the United States.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Bat Ray is presently one of the many species considered, but not yet actively regulated, under the Pacific Fishery Management Council's Groundfish Management Plan for the U.S. eastern Pacific. The state has general restrictions on usage of certain types of commercial gear in the nearshore zone, which offers a good degree of protection for Bat Ray and Pacific Angel Shark (Squatina californica; Leet et al. 2001). Despite the fact that there are no formal conservation measures, the demand for Bat Ray has been relatively low allowing for some protection for this species, at least within the centre of the known United States distribution. More needs to be learned about the status of critical reproductive and nursery habitat. If fishing mortality increases within regulatory constraints, could be problematic or this species, although it is unknown how much fishing pressure this species can withstand. In addition, a re-assessment of the combined sport and commercial harvest is recommended.

In Mxico, a moratorium on the issue of elasmobranch fishing permits was enacted in 1993, but no formal management plan has been implemented for M. californicus specifically or for most other chondrichthyans. However, legislation is currently being developed in Mxico to establish national elasmobranch fishery management. Elasmobranch landings in Mxico are poorly monitored and lack species specific details. All batoids are generally broadly termed "manta raya" in catch records. Although easily identified, these rays are rarely documented on a species-specific basis in Mxico. Improved clarity in catch records would provide an essential basis for detecting fishery trends and are needed throughout the species' range. Expanded monitoring of directed elasmobranch catches and bycatch in Mxico is necessary to provide valuable information on the biology and population status of these rays.

In addition to species-specific landings and bycatch details, life history information including age, growth, longevity, movement patterns, habitat use, and further reproductive studies throughout its range are needed from the southern portion of the species' range. Fishery-independent surveys of this and other demersal elasmobranchs are necessary to provide estimates of abundance and biomass. Tagging, tracking, and genetic studies are essential for determining the population structure, movement patterns, and possible subpopulations of this ray.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA-Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species in the USA and Mexico. At the time of writing, the USA has developed a National Plan of Action (NPOA), while Mexico had developed a NPOA but implementation has been blocked by industry (Anon. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative impacts of bat rays on humans. They were once thought to eat large numbers of cultivated oysters in coastal California. However, research demonstrated that bat rays only rarely prey on oysters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because bat rays are large predators that use their snouts to dig up food, they wind up creating extremely large pits up to 4m long and 20 cm deep. These large pits allow access to small organisms that may be the food of smaller fish. Small fish rely on this relationship with bat rays because a lot of them are unable to dig their own food out of the sand.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bat ray

The bat ray (Myliobatis californica)[1][2][3] is an eagle ray found in muddy or sandy sloughs, estuaries and bays, kelp beds and rocky-bottomed shoreline in the eastern Pacific Ocean, between the Oregon coast and the Gulf of California. It is also found in the area around the Galápagos Islands.[4] The largest specimens can grow to a wingspan of 1.8 m (5 ft 11 in) and a mass of 91 kg (201 lb).[5] They more typically range from 9.07–13.61 kg (20.0–30.0 lb). Bat rays are euryhaline, i.e. they are able to live in environments with a wide range of salinities.

Diet[edit]

Bat rays feed on mollusks, crustaceans and small fish on the seabed, using their winglike pectoral fins to move sand and expose prey animals. They may also dig trenches up to 20 cm deep to expose buried prey, such as clams. Bat ray teeth are flat and pavementlike, forming tightly-packed rows that are used for crushing and grinding prey—the crushed shells are ejected and the flesh consumed. As with all elasmobranchs, these teeth fall out and are replaced continuously.[4][5]

Relation to humans[edit]

While the bat ray, like other stingrays, has a venomous spine in its tail (near the base), it is not considered dangerous and uses the spine only when attacked or frightened.

Currently, the bat ray is fished commercially in Mexico but not the United States. However, it is sometimes fished for sport for its fighting characteristics. Prehistorically, native tribes on the California coast (probably Ohlone), especially in the San Francisco Bay area, fished bat rays in large numbers, presumably for food.[6]

Commercial growers have long believed bat rays (which inhabit the same estuarine areas favored for the industry) prey on oysters, and trapped them in large numbers. In fact, crabs (which are prey of bat rays) are principally responsible for oyster loss. Bat rays are not considered endangered or threatened.[5]

Bat Rays are popular in marine parks, and visitors are often allowed to touch or stroke the ray, usually on the wing.

Life cycle[edit]

Bat ray reproduction is ovoviviparous. They mate annually, in the spring or summer, and have a gestation period of nine to twelve months. Litter sizes range from two to ten — pups emerge with their pectoral fins wrapped around the body, and the venomous spine is flexible and covered in a sheath which sloughs off within hours of birth. Bat rays live up to 23 years.[5][7]

Bat rays copulate while swimming with synchronized wingbeats—the male under the female. The male inserts a clasper into the female's cloaca, channeling semen into the orifice to fertilize her eggs.[7]

Gallery[edit]

References[edit]

  1. ^ Gill, T.N. (1865). "Note on the family of myliobatoids, and on a new species of Aetobatis". Ann. Lyc. Nat. Hist. N. Y. 8, 135–138.
  2. ^ "Myliobatis californica". Integrated Taxonomic Information System. Retrieved 11 March 2006. 
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Myliobatis californica" in FishBase. January 2006 version.
  4. ^ a b Florida Museum of Natural History. Bat Ray Biological Profile. Retrieved 2006-01-16.
  5. ^ a b c d Monterey Bay Aquarium Online Field Guide. Bat Ray. Retrieved 2012-06-14.
  6. ^ Gobalet, Kenneth W., Peter D. Schulz, Thomas A. Wake and Nelson Siefkin (2004). "Archaeological perspectives on native American fisheries of California, with emphasis on steelhead and salmon". Transactions of the American Fisheries Society 133 (4), 801–833.
  7. ^ a b MarineBio.org. Bat Ray. Retrieved 2006-01-16
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!