Overview

Comprehensive Description

Biology

Inhabits shallow coral reefs over coral, sand, rubble or seagrass substrata (Ref. 46844). Forms tight coherent schools when chased (Ref. 80499). Feeds on zooplankton and forms evasive, compact schools when threatened (Ref. 46844).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is only known fromthe Caribbean Sea onclear-water reefs around inshore mangrove islands of the Belize Barrier Reef World Heritage Site, especially around the Pelican Cayes (Lobel et al. 2009). Its estimated AOO is 24 km (calculated by clipping the distribution polygon to the WCMC 2013 coral layer). Its estimated EOO is 203 km (based on a minimum convex polygon drawn around the extent of its range on the coral reef layer).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Off Belize, inside the barrier reef.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Atlantic: known only from Belize. Expected to be found elsewhere along the continental shores of the Caribbean Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 11 - 12; Vertebrae: 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

4.7 cm SL (male/unsexed; (Ref. 80499))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Head and back gray-green with a narrow midlateral black-brown stripe from front of snout to caudal fin base, ending in a prominent black spot; second narrow brown stripe on lower side, the pale gray zone on the lower side between the two black-brown stripes bisected by a narrow white stripe; a narrow brown stripe on body at each side of base of dorsal fin, continuing middorsally on nape as a double stripe; occiput dark brown; the black caudal base spot rimmed with blue and white except posteriorly (Ref. 46844).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Halichoeres socialis
Catalog Number: USNM 352855
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Lobel & Class
Year Collected: 1997
Locality: Belize, Pelican Cays, Tunicate Cove, Pelican Cays, Belize, Caribbean Sea, Atlantic
Depth (m): 1 to 5
  • Paratype: Randall, J. E. & Lobel, P. S. 2003. Copeia. 2003 (1): 125, 1-3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Halichoeres socialis
Catalog Number: USNM 352854
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Lobel & Class
Year Collected: 1997
Locality: Belize, Pelican Cays, Tunicate Cove, Pelican Cays, Belize, Caribbean Sea, Atlantic
Depth (m): 1 to 5
  • Holotype: Randall, J. E. & Lobel, P. S. 2003. Copeia. 2003 (1): 125, 1-3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adults are reef associated and juveniles are mangrove and shallow reef dependent. It is found in shallow coral reefs over coral, sand, rubble or seagrass substrata (Randall and Lobel 2003) to depths of 10 m. Juveniles feed on zooplankton and form evasive, compact schools when threatened (Randall and Lobel 2003).Life history traits (longevity and age of maturity) are based on similar species in this genus of similar size.Its estimated larval life is two to three weeks; however, it may not be able to disperse outside the known area given the lack of suitable habitat.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 3 - 3
  Temperature range (°C): 28.365 - 28.365
  Nitrate (umol/L): 0.469 - 0.469
  Salinity (PPS): 32.409 - 32.409
  Oxygen (ml/l): 4.614 - 4.614
  Phosphate (umol/l): 0.176 - 0.176
  Silicate (umol/l): 4.761 - 4.761
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 7 m (Ref. 46844)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 3 - 3
  Temperature range (°C): 28.365 - 28.365
  Nitrate (umol/L): 0.469 - 0.469
  Salinity (PPS): 32.409 - 32.409
  Oxygen (ml/l): 4.614 - 4.614
  Phosphate (umol/l): 0.176 - 0.176
  Silicate (umol/l): 4.761 - 4.761
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits shallow coral reefs over coral, sand, rubble or seagrass substrata (Ref. 46844). Feeds on zooplankton and forms evasive, compact schools when threatened (Ref. 46844).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoeres socialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTCGGCGCCTGAGCTGGGATAGTGGGTACGGCCTTGAGCCTACTTATTCGGGCTGAATTAAGCCAACCCGGCGCTCTCCTTGGGGAC---GACCAGATCTATAACGTAATCGTTACAGCCCACGCATTCGTAATAATTTTCTTTATAGTGATACCCATTATGATTGGCGGATTTGGAAATTGACTAATCCCCCTCATGATTGGTGCCCCTGACATGGCCTTCCCTCGAATAAATAATATAAGCTTTTGACTTCTCCCGCCTTCCTTCCTCCTCCTGCTTGCCTCTTCTGGTGTAGAGGCTGGAGCCGGTACCGGATGAACAGTTTACCCGCCTTTAGCAGGAAATCTTGCGCACGCCGGTGCATCTGTAGACCTCACAATCTTTTCTCTCCACCTGGCCGGTATTTCGTCAATTCTGGGGGCTATCAACTTCATTACTACTATTATTAATATGAAGCCTCCTGCTATTTCCCAATATCAAACGCCCCTCTTCGTTTGAGCCGTCCTAATTACAGCCGTACTTCTCCTCCTTTCCCTCCCAGTCCTTGCCGCTGGCATTACAATGCTTCTTACAGATCGAAATTTAAATACTACTTTCTTTGACCCGGCTGGAGGGGGCGATCCAATTTTATACCAACACTTATTCTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres socialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
B1ab(i,ii,iii,v)+2ab(i,ii,iii,v)

Version
3.1

Year Assessed
2015

Assessor/s
Rocha, L.A.

Reviewer/s
Linardich, C.

Contributor/s

Justification
This species is restricted to a single location (the Belize Barrier Reef World Heritage Site) and has an estimated extent of occurrence (EOO) of 203 km and an area of occupancy (AOO) of 24 km. It is dependent on a unique combination of shallow coral and mangrove habitat, especially for juveniles. Significant habitat loss is occurring due to mangrove and coral removal for extensive coastal development within its very restricted range.

Since its original publication on the Red List in 2008, a new major threat has evolved in the spread of the invasive Lionfish, (Pterois volitans) which now encompasses the entire region of the greater Caribbean. Recent studies have revealed that Halichoeres socialis constitutes half of the Lionfish diet, with both juveniles and adults being consumed. Although a quantified population decline is not yet known, studies conducted elsewhere in areas of high Lionfish density have demonstrated reef fish biomass declines of 32-65%. Due to its predominance in the diet, this species is likely experiencing a much higher decline than the average reef fish. Since Lionfish populations off Belize have the potential to grow in density, this threat is expected to increase in magnitude.

Since the number of mature individuals and rate of decline are not known at this time, the species is listed as Endangered (EN B1ab(i,ii,iii,v)+B2ab(i,ii,iii,v)). Research is urgently needed on this species' population status, as it may qualify for a higher level of extinction risk. Furthermore, immediate conservation action is needed that implements Lionfish control measures and prevents destruction of its sensitive habitat.

History
  • 2010
    Critically Endangered (CR)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Currently, population size and trends have not been assessed. From the original description, it may seem that the population numbers are high, as juveniles are abundant where they occur. However, adult individuals are rarely observed.

The population is very likely suffering rapid declines due to predation by the invasive Lionfish (Pterois volitans) on both adults and juveniles; however, this decline has not yet been quantified (Rocha et al. 2015).Since the first Belizean sighting occurred in 2008, this threat has been growing with the rapidly increasing Lionfish population over the past seven years.Studies conducted in areas with high densities of Lionfish (Bahamas) have documented reef fish biomass declines of 32-65% over a period of two years (Green et al. 2012, Albins 2015). Belizean Lionfish populations have the potential to continue to increase in density (Chapman et al. 2013, Hackerott 2014); therefore, Social Wrasse population declines are expected to continue as well as increase in magnitude into the future.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is threatened by habitat destruction occurring throughout its range: extensive mangrove and coral removal and dredging activity related to coastal and resort development has been occurring since at least 2003. Since it was first assessed in 2008, the invasive Lionfish has been added as another major threat. Due to its small size, schooling, and hovering behaviour, it is easily and frequently targeted (Green and Cote 2014). In a study conducted throughout the range of H. socialis, it comprised almost half of the Lionfish diet, with both juveniles and adults being consumed (Rocha et al. 2015).

Population declines have not yet been quantified; however, studies in the Bahamas have observed a 32-65% decline in reef fish biomass over a period of two years due to predation by the invasive Lionfish (Green et al. 2012, Albins 2015). A study conducted in the same area by Ingeman and Webster (2015), found that local populations of Gramma loreto (also a common prey item of the Lionfish) face an elevated risk of extirpation as a result of increased predation. Based on these data, the population decline is suspected to be rapid and likely increase into the future as the Lionfish population density grows off Belize.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Critically Endangered (CR) (B1ab(iii))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Pelican Cayes are designated as a World Heritage Site, but no actual protective measures are enforced. Given its very small range, ongoing habitat loss, and susceptibility to invasive Lionfish predation, this species should be monitored and conservation measures implemented. Targeted Lionfish removal is greatly needed in this area (Rocha et al. 2015).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!