Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Secretive species found in lagoon and seaward reef slopes in areas with rich coral growth. Found singly or in aggregations (Ref. 1602); forms harems of 3-7 individuals. Feeds on algae. Frequently exported through the aquarium trade (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Tuamoto Islands, north to the Izu Island, south to Lord Howe Island. Not found in the Red Sea, Hawaii, and the southern Pacific Ocean (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Aldabra, Madagascar and Mascarenes east to Marshall and Tuamotu islands, north to Izu Islands, south to Western Australia, Lord Howe Island, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14; Dorsal soft rays (total): 16 - 18; Analspines: 3; Analsoft rays: 17 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 5953))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Color in life variable; predominantly light orange with the barring broken into a series of spots; others almost entirely purple (Ref. 1602). Body depth 1.7-2.0 in SL. Scales longitudinal series 42-45 (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 111 specimens in 1 taxon.
Water temperature and chemistry ranges based on 61 samples.

Environmental ranges
  Depth range (m): 1.75 - 39.5
  Temperature range (°C): 24.633 - 28.905
  Nitrate (umol/L): 0.019 - 1.118
  Salinity (PPS): 33.913 - 35.924
  Oxygen (ml/l): 4.387 - 4.851
  Phosphate (umol/l): 0.070 - 0.238
  Silicate (umol/l): 0.721 - 3.715

Graphical representation

Depth range (m): 1.75 - 39.5

Temperature range (°C): 24.633 - 28.905

Nitrate (umol/L): 0.019 - 1.118

Salinity (PPS): 33.913 - 35.924

Oxygen (ml/l): 4.387 - 4.851

Phosphate (umol/l): 0.070 - 0.238

Silicate (umol/l): 0.721 - 3.715
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 5 - 45 m (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 111 specimens in 1 taxon.
Water temperature and chemistry ranges based on 61 samples.

Environmental ranges
  Depth range (m): 1.75 - 39.5
  Temperature range (°C): 24.633 - 28.905
  Nitrate (umol/L): 0.019 - 1.118
  Salinity (PPS): 33.913 - 35.924
  Oxygen (ml/l): 4.387 - 4.851
  Phosphate (umol/l): 0.070 - 0.238
  Silicate (umol/l): 0.721 - 3.715

Graphical representation

Depth range (m): 1.75 - 39.5

Temperature range (°C): 24.633 - 28.905

Nitrate (umol/L): 0.019 - 1.118

Salinity (PPS): 33.913 - 35.924

Oxygen (ml/l): 4.387 - 4.851

Phosphate (umol/l): 0.070 - 0.238

Silicate (umol/l): 0.721 - 3.715
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 9 - 45m.
From 9 to 45 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Secretive species found in lagoon and seaward reef slopes in areas with rich coral growth. Found singly or in aggregations.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropyge bispinosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTATTTATTATTTGGTGCTTGAGCTGGGATAGTAGGTACAGCTTTAAGCCTGCTTATCCGAGCAGAACTTAATCAGCCAGGCAGCCTCCTTGGAGATGACCAAATCTACAATGTTATCGTTACAGCACATGCGTTTGTAATAATTTTTTTTATAGTTATACCGGCCATAATCGGAGGATTTGGAAACTGACTGGTCCCACTAATAATTGGGGCCCCAGACATGGCATTCCCCCGAATGAATAATATAAGCTTTTGACTCCTGCCCCCCTCCCTTCTTCTTCTCCTAGCTTCTGCTGGCGTAGAAGCCGGGGCCGGCACTGGATGGACAGTTTACCCCCCTCTAGCTGGCAACCTAGCCCACGCAGGTGCATCAGTAGACTTAACCATCTTCTCCCTCCACCTAGCAGGGGTTTCCTCAATTTTAGGAGCTATTAATTTCATCACCACAATTATTAATATGAAACCTCCAGCTATTTCCCAGTACCAGACACCTTTATTTGTCTGAGCAGTACTAATTACAGCAGTCCTCCTACTTCTCTCCCTTCCAGTCCTTGCGGCGGGGATTACAATGCTTCTCACAGACCGAAACCTCAATACCACTTTCTTCGACCCCGCAGGGGGAGGAGACCCAATTCTTTACCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Centropyge bispinosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Twospined angelfish

The Twospined Angelfish, Dusky Angelfish, or Coral Beauty (Centropyge bispinosa), is a marine angelfish.

Some individuals have a dark purplish blue body with yellow to red stripes, and usually an electric blue rim; in others are orange stripes dominate, with the purple distributed in spots. Some bright orange forms are very similar in appearance to the golden angelfish, Centropyge aurantia.

The twospined angelfish is native to the Indo-Pacific where it lives in coral reefs and lagoons. It reaches a maximum length of 3 inches (8 cm). It eats algae.

When kept in an aquarium they may have a tendency to nip on corals, especially soft corals and clam mantles. This species is suitable for beginners, as it is considered one of the hardier dwarf angels. Due to their high metabolisms, feeding usually needs to be done at least every other day. Once established, they are generally a long-lived species. There is also a deep water version of this species.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!