Overview

Comprehensive Description

Biology

Inhabits shallow coastal waters, on sandy and muddy bottoms, and not normally found in lagoons and estuaries (Ref. 244). Feeds on small bony fishes, including sardines and anchovies, also shrimp and squid (Ref. 244). Viviparous, with 1 to 4 young in a litter; size at birth 33 to 34 cm (Ref. 244). Its flesh is highly appreciated and is marketed dried salted.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Panama to southern Brazil and Uruguay (Ref. 58839).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic, from Panama to southern Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

77 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 22 - 29
  Temperature range (°C): 26.480 - 27.999
  Nitrate (umol/L): 0.286 - 0.926
  Salinity (PPS): 35.836 - 36.010
  Oxygen (ml/l): 4.294 - 4.430
  Phosphate (umol/l): 0.040 - 0.218
  Silicate (umol/l): 3.147 - 4.128

Graphical representation

Depth range (m): 22 - 29

Temperature range (°C): 26.480 - 27.999

Nitrate (umol/L): 0.286 - 0.926

Salinity (PPS): 35.836 - 36.010

Oxygen (ml/l): 4.294 - 4.430

Phosphate (umol/l): 0.040 - 0.218

Silicate (umol/l): 3.147 - 4.128
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 3 - 70 m (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 22 - 29
  Temperature range (°C): 26.480 - 27.999
  Nitrate (umol/L): 0.286 - 0.926
  Salinity (PPS): 35.836 - 36.010
  Oxygen (ml/l): 4.294 - 4.430
  Phosphate (umol/l): 0.040 - 0.218
  Silicate (umol/l): 3.147 - 4.128

Graphical representation

Depth range (m): 22 - 29

Temperature range (°C): 26.480 - 27.999

Nitrate (umol/L): 0.286 - 0.926

Salinity (PPS): 35.836 - 36.010

Oxygen (ml/l): 4.294 - 4.430

Phosphate (umol/l): 0.040 - 0.218

Silicate (umol/l): 3.147 - 4.128
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 70m.
From 3 to 70 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits shallow coastal waters, on sandy and muddy bottoms, and not normally found in lagoons and estuaries. Feeds on small bony fishes, including sardines and anchovies, also shrimp and squid.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing with embrace (Ref. 205). Viviparous, placental (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhizoprionodon lalandii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTTCTAATTCGAGCCGAACTTGGTCAACCTGGATCTCTTTTAGGTGATGATCAGATTTACAATGTGATCGTAACTGCCCACGCTTTTGTAATAATCTTTTTTATGGTAATACCAATTATAATTGGTGGTTTCGGAAATTGACTGGTTCCTTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGCTTTTGACTCCTTCCACCTTCATTCCTTCTTCTCCTAGCTTCTGCTGCAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTATCCCCCATTAGCTAGCAATCTAGCTCACGCCGGACCATCTGTCGACCTAGCTATTTTCTCCCTTCATTTAGCCGGCGTTTCATCAATTTTAGCCTCAATTAACTTTATTACAACCATTATTAACATAAAACCACCAGCTATTTCCCAATATCAAACACCTTTATTTGTTTGATCTATTCTTGTAACTACTATTCTCCTTCTCCTTTCACTTCCAGTTCTTGCAGCAGGAATTACAATATTACTTACAGATCGCAACCTTAATACCACATTCTTTGATCCTGCAGGTGGGGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhizoprionodon lalandii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brazilian sharpnose shark

The Brazilian sharpnose shark, Rhizoprionodon lalandii, is a requiem shark of the family Carcharhinidae. It is found in the tropical waters of the western Atlantic Ocean between latitudes 13° N and 33° S, at depths between 3 to 70 m. It can reach a length of 77 cm.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!