Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Despite the bronze whaler being a fairly common species, its biology is relatively poorly known due to confusion with other species (3). It is a viviparous shark, and thus the embryos develop within the mother and are provided nutrition via a yolk-sac placenta. Gestation is thought to last for about one year, after which a litter of 13 to 24 pups, measuring 59 to 70 centimetres, are born. Male bronze whalers reach maturity at around 13 years; females are mature at around 20 years (5). Schools of adult and juvenile bronze whalers appear to segregate. Juveniles are present in shallow water all year round, whilst adults are found inshore only in spring and summer. Adult males occur in subtropical regions throughout the year, whereas females and immature sharks migrate to these regions during winter, and then return to temperate regions (and inshore) in the spring to breed (1). However, despite this migration, there is very little movement between adjacent regional populations (5). Nursery areas tend to be large and ill defined but include shallow banks, large shallow bays, inlets and harbours as well as the open coast (1). Bronze whalers can be found singly, or in loose schools of up to one hundred individuals (1). They feed on bony fishes, such as sardines, mullets, hake and soles, as well as other prey such as sawfish, squid and cuttlefish (3) (5). Large numbers follow the winter sardine run off the southern Natal coast, South Africa to feast on one of their preferred prey (5). This powerful and fast shark is considered to be a dangerous species, and there have been a few provoked and unprovoked attacks on swimmers and divers (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Named for its bronze, or sometimes greyish-bronze upperside, this is a large, fairly slender shark with a moderately long and slightly pointed snout. The underside is white, and most of the fins have inconspicuous darker edges and dusky to black tips. Both the large, pointed first dorsal fin and the long pectoral fins are sickle-shaped. Often, a prominent white band runs down the flanks (3). Its common name 'whaler' arose in the nineteenth century, due to their habit of congregating around the carcasses of harpooned whales hanging along the side of whaling boats (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: shark (English), tiburón (Espanol)
 
Carcharhinus brachyurus (Günther, 1870)


Narrowtooth shark,     Copper shark,     Bronze whaler shark


Body slender;  snout blunt, broad, rounded, its length 1.1-1.4 times the distance between nostrils; nasal orifices small and well separated; round eye; spiracle absent; upper front teeth narrow and hooked, with finely serrated points; lower front teeth narrow, high, straight; 5 short gill slits, last 2 over pectoral fin base; first dorsal moderately high (6.8-9.7% of TL), front edge straight, origin over or just behind rear edge of pectoral; second dorsal moderately high origin over anal origin; pectoral long, straight; usually no raised crest on back between dorsal fins; tail strongly asymmetrical, with well developed lower lobe, undulating ridge along dorsal surface of top lobe, and a ventral notch near tip of that lobe; notch on top of tail base.

Dark grey-brown above, belly whitish; a pale stripe along flank; tips of pelvics and tips and rear borders of pectorals dark to blackish.

Size: 325 cm.

Habitat: inshore to offshore, continental, from surfline deeper.

Depth: 0-360 m.

Circumglobal; California to the Gulf of California and central Mexico, the Revillagigedos, Peru.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A coastal and offshore shark (Ref. 9997) found along continental margins in most tropical and temperate seas. Occasionally enters large coastal bays and inshore areas (Ref. 6390). Occasionally found near the bottom (Ref. 6808). Migratory in the northern part of its range, moving northward in spring and summer and southward in autumn and winter (Ref. 244). Feeds on pelagic and bottom bony fishes, cephalopods, and small sharks and rays (Ref. 5578). Viviparous (Ref. 50449). Undoubtedly utilized for human consumption where it occurs (Ref. 244). Implicated in shark attacks on people (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 0 (S) - 360 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), West + East Pacific (but not Central), East Pacific + Atlantic (East +/or West), East Pacific + East (not West) Atlantic

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), South Temperate (Peruvian Province ), Antitropical (North and South temperate)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Mexico, Gulf of Mexico, Brazil to Argentina. Eastern Atlantic: off France southward and around the coast of southern Africa to central Natal, South Africa (Ref. 5578), including the Mediterranean. Possibly two separate populations in southern Africa (Ref. 3209). Western Pacific: Japan to New Zealand. Eastern Pacific: southern California, USA to the Gulf of California in Mexico and Peru.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nearly circumblobal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in most warm temperate waters in the Indo-Pacific, Atlantic and Mediterranean (5). The East Asia subpopulation has been recorded from the coastal waters off Japan, China, North and South Korea and southern Siberia (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 325.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 3250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

325 cm TL (male/unsexed; (Ref. 2334)); max. published weight: 304.6 kg (Ref. 40637); max. reported age: 30 years (Ref. 3209)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found along continental margins in most tropical and temperate seas. Feeds on other sharks, rays, bony fishes, and cephalopods. Viviparous, with a yolk-sac placenta, and has litters of 13 to 20 pups, 60 to 70 cm at birth (Ref. 2334). Migratory in the northern part of its range, moving northward in spring and summer and southward in autumn and winter. Utilized for human consumption. Considered a dangerous species.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A large shark to with a bluntly pointed, broad snout, narrow, bent cusps on the upper teeth, and with no interdorsal ridge (Ref. 5578). Grey to bronzy in color, white below (Ref. 5578); fins mostly plain except for dusky tips on pelvic fins, as well as dusky to black tips and rear edges on pectoral fins (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Carcharhinus brachyurus
Catalog Number: USNM 114946
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1938
Locality: New South Wales, Off Sydney, New South Wales, Australia, Pacific
  • Syntype: Stead, D. G. 1938. The Australian Naturalist. 10 (3): 102.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Carcharhinus brachyurus
Catalog Number: USNM 27366
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Diego, California, San Diego County, California, United States, Pacific
  • Type: Jordan, D. S. & Gilbert, C. H. 1882. Proceedings of the United States National Museum. 5 (269): 110.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 39 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 23 - 536
  Temperature range (°C): 6.409 - 20.525
  Nitrate (umol/L): 0.276 - 21.897
  Salinity (PPS): 34.440 - 35.993
  Oxygen (ml/l): 4.364 - 5.304
  Phosphate (umol/l): 0.134 - 1.821
  Silicate (umol/l): 1.128 - 18.665

Graphical representation

Depth range (m): 23 - 536

Temperature range (°C): 6.409 - 20.525

Nitrate (umol/L): 0.276 - 21.897

Salinity (PPS): 34.440 - 35.993

Oxygen (ml/l): 4.364 - 5.304

Phosphate (umol/l): 0.134 - 1.821

Silicate (umol/l): 1.128 - 18.665
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Near Surface, Mid Water, Near Bottom, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 360 m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 39 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 23 - 536
  Temperature range (°C): 6.409 - 20.525
  Nitrate (umol/L): 0.276 - 21.897
  Salinity (PPS): 34.440 - 35.993
  Oxygen (ml/l): 4.364 - 5.304
  Phosphate (umol/l): 0.134 - 1.821
  Silicate (umol/l): 1.128 - 18.665

Graphical representation

Depth range (m): 23 - 536

Temperature range (°C): 6.409 - 20.525

Nitrate (umol/L): 0.276 - 21.897

Salinity (PPS): 34.440 - 35.993

Oxygen (ml/l): 4.364 - 5.304

Phosphate (umol/l): 0.134 - 1.821

Silicate (umol/l): 1.128 - 18.665
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 100m.
Recorded at 100 meters.

Habitat: pelagic. Copper shark.  Gunther, 1870 Attains 2.9 Metres. Litter of 13 - 20 pups. Has been blamed for several attacks on man. Common from Namibia to Port Elizabeth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bronze whaler can be found from the surfline to depths of at least 100 metres (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These sharks enter estuaries occasionally. Found from surf zone to at least 100 m (Refs. 6390, 6871). Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, with a yolk-sac placenta. Litter contains 7 to 20 pups (Ref. 6871, 6390). Young born at 59 - 70 cm TL (Ref. 6390). Pupping may occur at any time of the year but there is a peak in births in summer (Ref. 6390). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 34.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus brachyurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGGCAACCTGGATCACTTTTAGGGGATGATCAGATCTACAATGTAATCGTAACCGCCCACGCTTTTGTAATAATCTTTTTCATGGTTATACCAATTATAATTGGTGGTTTCGGAAATTGACTAGTTCCTTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTCCTTCCACCATCATTTCTTCTTCTCCTCGCCTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTACCCTCCATTAGCTAGCAACCTAGCACATGCTGGACCATCTGTTGATTTAGCTATTTTCTCTCTTCACTTAGCCGGTGTTTCATCAATTTTAGCTTCAATTAATTTTATCACAACTATTATTAACATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTCTCACTTCCAGTCCTTGCAGCAGGGATTACAATATTACTTACAGATCGTAACCTTAATACTACATTCTTTGACCCTGCAGGCGGAGGAGACCCAATCCTTTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus brachyurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1). The East Asia subpopulation is classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is little information regarding the extent to which the bronze whaler is utilized, but it is undoubtedly caught for food, by sports anglers and taken as by-catch in a number of areas (1) (3) (5). As the bronze whaler is exceptionally slow to reproduce, it is particularly vulnerable to over fishing (3) (5). The East Asia subpopulation is the target of commercial fishing in China and contributes to the catch of shark fisheries in East Asia since the 1950s. However, fisheries for large coastal sharks in the region appear to have ceased during the 1970s due to declining catches. This apparent collapse of coastal shark fisheries indicates a decline in the East Asia subpopulation, and multi-species fisheries in the region are likely to continue to impact the population (1). The bronze whaler may also be threatened by degradation of their inshore nursery habitats, which are vulnerable to the effects of human development and pollution (1) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

There are few conservation measures in place aimed specifically at the bronze whaler. In Australia and New Zealand, measures aimed at other species are likely to also be beneficial to the bronze whaler, for example, bans on taking school and gummy sharks from nursery areas in Tasmania, and a ban on gill netting out to five nautical miles from shore off the northwest North Island, New Zealand (1). Specific conservation actions may be required to conserve this magnificent ocean predator.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Copper shark

The copper shark, bronze whaler, or narrowtooth shark (Carcharhinus brachyurus) is a species of requiem shark, family Carcharhinidae, and the only member of its genus found mostly at temperate latitudes. It is distributed in a number of separate populations in the northeastern and southwestern Atlantic, off southern Africa, in the northwestern and eastern Pacific, and around Australia and New Zealand, with scattered reports from equatorial regions. This species can be found from brackish rivers and estuaries, to shallow bays and harbors, to offshore waters 100 m (330 ft) deep or more. Females are found apart from males for most of the year, and conduct seasonal migrations. A large species reaching 3.3 m (11 ft) long, the copper shark is difficult to distinguish from other large requiem sharks. It is characterized by its narrow, hook-shaped upper teeth, lack of a prominent ridge between the dorsal fins, and plain bronze coloration.

Feeding mainly on cephalopods, bony fishes, and other cartilaginous fishes, the copper shark is a fast-swimming predator that often hunts in large groups, utilizing their numbers to their advantage. Off South Africa, this species associates closely with the annual sardine run, involving millions of southern African pilchard (Sardinops sagax). Like other requiem sharks, it is viviparous, with the developing embryos mainly nourished through a placental connection formed from the depleted yolk sac. Females bear litters of 7 to 24 pups every other year in coastal nursery areas, after a gestation period of 12 or perhaps as long as 21 months. It is extremely slow-growing, with males and females not reaching maturity until 13–19 and 19–20 years of age respectively.

This species is valued by commercial and recreational fisheries throughout its range, and utilized as food. The species population size is unknown,[3] but the ICUN's Red List assesses the species as Near Threatened because it is very susceptible to population depletion due to its low growth and reproductive rates and because its numbers are believed to have declined in some areas.

Copper sharks only attack humans infrequently, but the species places sixth in the number of unprovoked attacks on people.[4]

Taxonomy[edit]

Because of its very patchy range, the copper shark has been scientifically described several times from different locales. The earliest valid description is presently considered to be British zoologist Albert Günther's account of Carcharias brachyurus in the 1870 eighth volume of Catalogue of the fishes in the British Museum.[5] The earliest name was once thought to be Auguste Duméril's 1865 Carcharias remotus, until it was found that the type specimen associated with that name is actually a blacknose shark (C. acronotus). Thus, this shark was often referred to as C. remotus in older literature.[6] An even earlier name, Richard Owen's 1853 Galeolamna greyi, is of questionable taxonomic status as it was based solely on a set of now-destroyed jaws that may or may not have belonged to a copper shark. Modern authors have assigned this species to the genus Carcharhinus.[7]

The specific epithet brachyurus is derived from the Greek brachys ("short") and oura ("tail").[6] The name "whaler" originated in the 19th century, applied by the crews of whaling vessels in the Pacific who saw large sharks of various species congregating around harpooned whale carcasses.[8] This species may also be referred to as black-tipped whaler, cocktail shark or cocktail whaler, or New Zealand whaler, as well as by the shortened "bronze", "bronzie", or "cocktail".[1][9] Günther originally referred to four syntypes: a stuffed specimen from Antarctica and another from New Zealand, which have since been lost, and two fetuses from Australia that were later discovered to be bull sharks (C. leucas).[5][7] In the interests of taxonomic stability, in 1982 Jack Garrick designated a 2.4 m (7.9 ft) long female caught off Whanganui, New Zealand as a new type specimen.[10]

Phylogeny and evolution[edit]

The first efforts to determine the evolutionary relationships of the copper shark were based on morphology and returned inconclusive results: in 1982 Jack Garrick placed it by itself as a grouping within Carcharhinus, while in 1988 Leonard Compagno placed it in an informal "transitional group" that also contained the blacknose shark (C. acronotus), the blacktip reef shark (C. melanopterus), the nervous shark (C. cautus), the silky shark (C. falciformis), and the night shark (C. signatus).[10][11] Gavin Naylor's 1992 allozyme study concluded that the closest relative of the copper shark is the spinner shark (C. brevipinna), but could not resolve their wider relationships with the rest of the genus.[12] Fossilized teeth from the copper shark have been recovered from the Pungo River in North Carolina, dating to the Miocene (23–5.3 Ma),[13] from Tuscany, dating to the Pliocene (5.3–2.6 Ma),[14] and from Costa Mesa in California, dating to the Late Pleistocene (126,000–12,000 years ago).[15]

Distribution and habitat[edit]

The copper shark is the only member of its genus largely found in temperate rather than tropical waters, in temperatures above 12 °C (54 °F).[10] It is widely distributed but as disjunct regional populations with little to no interchange between them. In the Atlantic, this shark occurs from the Mediterranean Sea to Morocco and the Canary Islands, off Argentina, and off Namibia and South Africa (where there may be two separate populations),[16] with infrequent records from Mauritania, the Gulf of Guinea, and possibly the Gulf of Mexico. In the Indo-Pacific, it is found from the East China Sea to Japan (excluding Hokkaido) and southern Russia, off southern Australia (mostly between Sydney and Perth but occasionally further north), and around New Zealand but not as far as the Kermadec Islands; there are also unconfirmed reports from the Seychelles and the Gulf of Thailand. In the eastern Pacific, it occurs from northern Chile to Peru, and from Mexico to Point Conception, California, including the Gulf of California. The copper shark is common off parts of Argentina, South Africa, Australia, and New Zealand, and rare elsewhere; in many areas its range is ill-defined because of confusion with other species.[1][7]

Copper sharks can be found from the surf zone to slightly beyond the continental shelf in the open ocean, diving to depths of 100 m (330 ft) or more. This species commonly enters very shallow habitats, including bays, shoals, and harbors, and also inhabits rocky areas and offshore islands.[1][17] It is tolerant of low and changing salinities, and has been reported from estuaries and the lower reaches of large rivers. Juveniles inhabit inshore waters less than 30 m (98 ft) deep throughout the year, while adults tend to be found further offshore and regularly approach the coast only in spring and summer, when large aggregations can be readily observed in shallow water.[1]

Populations of copper sharks in both hemispheres perform seasonal migrations, in response to temperature changes, reproductive events, and/or prey availability; the movement patterns differ with sex and age.[1][6] Adult females and juveniles spend winter in the subtropics and generally shift to higher latitudes as spring nears, with pregnant females also moving towards the coast to give birth in inshore nursery areas. Adult males remain in the subtropics for most of the year, except in late winter or spring when they also move into higher latitudes, in time to encounter and mate with post-partum females dispersing from the nurseries. During migrations, individual sharks have been recorded traveling up to 1,320 km (820 mi). It is philopatric, returning to the same areas year after year.[1]

Description[edit]

Side view of a shark with a slightly arched profile behind the head, a triangular first dorsal fin, and a large, asymmetrical tail
The copper shark can be difficult to distinguish from other large Carcharhinus species.

The copper shark has a slender, streamlined body with a slightly arched profile just behind the head.[7][18] The snout is rather long and pointed, with the nostrils preceded by low flaps of skin. The round, moderately large eyes are equipped with nictating membranes (protective third eyelids). The mouth has short, subtle furrows at the corners and contains 29–35 upper tooth rows and 29–33 lower tooth rows. The teeth are serrated with single narrow cusps; the upper teeth have a distinctive hooked shape and become more angled towards the corners of the jaw, while the lower teeth are upright.[7][19] The upper teeth of adult males are longer, narrower, more curved, and more finely serrated than those of adult females and juveniles.[6] The five pairs of gill slits are fairly long.[7]

The pectoral fins are large, pointed, and falcate (sickle-shaped). The first dorsal fin is tall, with a pointed apex and a concave trailing margin; its origin lies about even with the tips of the pectoral fins. The second dorsal fin is small and low, and positioned about opposite to the anal fin. There is usually no ridge between the dorsal fins. The caudal fin has a well-developed lower lobe and a deep ventral notch near the tip of the upper lobe. This species is bronze to olive-gray above with a metallic sheen and sometimes a pink cast, darkening towards the fin tips and margins but not conspicuously so; the color fades quickly to a dull gray-brown after death. The underside is white, which extends onto the flanks as a prominent band.[7][8][19] [20]The copper shark is easily mistaken for other large Carcharhinus species, particularly the dusky shark (C. obscurus), but can be identified by its upper tooth shape, absent or weak interdorsal ridge, and lack of obvious fin markings.[21] It reportedly reaches a maximum length of 3.3 m (11 ft) and weight of 305 kilograms (672 lb).[9]

Biology and ecology[edit]

Fast and active, the copper shark may be encountered alone, in pairs, or in loosely organized schools containing up to hundreds of individuals. Some aggregations seem to form for reproductive purposes, while others form in response to concentrations of food.[1][17] This species may fall prey to larger sharks.[21] Known parasites of the copper shark include the tapeworms Cathetocephalus australis,[22] Dasyrhynchus pacificus and D. talismani,[23] Floriceps minacanthus,[24] Phoreiobothrium robertsoni,[25] and Pseudogrillotia spratti,[26] the leech Stibarobdella macrothela,[27] and the fluke Otodistomum veliporum.[21]

Feeding[edit]

A school of small, slim-bodied, silvery fish
Southern African pilchard are the most important prey species of copper sharks off South Africa.

The copper shark feeds more towards the bottom of the water column than the top, consuming cephalopods, including squid (Loligo spp.), cuttlefishes, and octopus; bony fishes, including gurnards, flatfishes, hakes, catfishes, jacks, Australian salmon, mullets, sea breams, smelts, tunas, sardines, and anchovies; and cartilaginous fishes, including dogfish sharks (Squalus spp.), stingrays, skates, electric rays, and sawfishes.[1][18] Cephalopods and cartilaginous fishes become relatively more important food for sharks over 2 m (6.6 ft) long.[28] Young sharks also consume scyphozoan jellyfish and crustaceans, including mud shrimps (Callianassa) and penaeid prawns.[1] It does not attack marine mammals, though has been known rarely to scavenge on dolphins that had succumbed to fishing nets.[29] The predominant prey of this species off South Africa is the southern African pilchard (Sardinops sagax), which comprise 69–95% of its diet. Every winter, schools of copper sharks follow the "run" of the pilchard from the Eastern Cape to KwaZulu-Natal.[30] The gathering of millions of forage fish attract a multitude of predators, including several species of sharks, of which copper sharks are the most numerous.[31]

Large numbers of copper sharks have been observed hunting together in a seemingly cooperative fashion. Small schooling fish are "herded" into a tight ball, whereupon each shark swims through in turn with its mouth open to feed. For groups of tuna and larger prey, the pursuing sharks may adopt a "wing" formation to force their quarry closer together, with each shark targeting a particular fish and attacking in turn.[6] In False Bay, South Africa, this species reportedly follows seine net fishing vessels.[32]

Life history[edit]

Like other members of its family, the copper shark is viviparous, in which the yolk sac of the developing embryo, once depleted, is converted into a placental connection through which the mother delivers nourishment.[1] Adult females have one functional ovary, on the right, and two functional uteruses.[33] The male bites the female as a prelude to mating. In the Southern Hemisphere, mating takes place from October to December (spring and early summer), when both sexes have migrated into offshore waters at higher latitudes. Birthing seems to occur from June to January, peaking in October and November.[1][30][33]

Female copper sharks make use of shallow inshore habitats, varying from stretches of open coast to more sheltered bays and inlets, as nurseries.[1][33] These nurseries provide abundant food and reduce the likelihood of predation by larger members of the species.[28] Known and suspected nursery areas occur off northern North Island from Waimea Inlet to Hawke Bay for New Zealand sharks, off Albany, in and around Gulf St Vincent, and in Port Phillip Bay for Australian sharks, off Niigata (Japan) for northwestern Pacific sharks, off the Eastern Cape for South Africa sharks, off Rhodes (Greece), Nice (France), and Al Hoceima (Morocco) for Mediterranean sharks, off Río de Oro (Western Sahara) for northwest African sharks, off Rio de Janeiro (Brazil) and Buenos Aires and Bahía Blanca (Argentina) for southwestern Atlantic sharks, and off Paita and Guanape Cove (Peru), in Sebastián Vizcaíno Bay (Mexico), and in and around San Diego Bay for eastern Pacific sharks.[1]

Most sources estimate a gestation period of 12 months, though some data support the interpretation of a 15–21 month long gestation period instead.[1][30] Females produce litters every other year, with the number of pups ranging from 7 to 24 and averaging 15 or 16. Females off California and the Baja Peninsula tend to bear fewer young relative to other parts of the world. The newborns measure 55–67 cm (22–26 in) long.[1][6] The copper shark is among the slowest-growing Carcharhinus species: off South Africa, males reach sexual maturity at 2.0–2.4 m (6.6–7.9 ft) long and an age of 13–19 years, while females mature at 2.3–2.5 m (7.5–8.2 ft) long and an age of 19–20 years.[16] Females off Australia mature at a comparable length of 2.5 m (8.2 ft), while females off Argentina mature at a slightly smaller length of 2.2 m (7.2 ft).[1][33] The maximum lifespan is at least 30 years for males and 25 years for females.[16]

Human interactions[edit]

The copper shark is often caught by recreational anglers.

Attacks on Humans[edit]

Copper sharks attack humans infrequently, but the species places sixth in the number of unprovoked attacks on people. During the tracking period through 2013, the University of Florida attributed 20 attacks to the species.[4] (In comparison, great white sharks topped the list, with 279 attacks.) Though large and powerful, the copper shark is not particularly aggressive towards humans unless in the presence of food. Copper Sharks have been known to harass and attack spear fishers in an attempt to steal catches. Copper sharks have bitten several swimmers in Australia and New Zealand,[6][8] where the species is common. (The species is commonly called bronze whalers in this part of the world.)

Fatal attacks attributed to the copper shark (bronze whaler) include the 2014 death of a swimmer in Tathra, New South Wales, Australia,[34] and the 1976 death of a swimmer in Te Kaha, New Zealand.[35] Three out of ten shark attacks in New Zealand are attributed to Copper sharks.[36] Witnesses also attributed a fatal attack on September 2011 in Bunker Bay, Western Australia to a copper shark.[37]

One problem with counting attacks on humans is that the copper shark is so similar to other requiem sharks. Victims and witnesses are unlikely to correctly identify which type of genus Carcharhinus shark is responsible for the attack.[38] Experts trying to confirm shark attacks by species warn that their statistics undercount the number of attacks by requiem sharks like the copper.[39]

Captivity[edit]

Like many large, active sharks, this species adapts poorly to captivity; it tends to bump into the sides of its enclosure, and the resulting abrasions then become infected with often fatal consequences.[17]

Fishing[edit]

Commercial fisheries for the copper shark exist off New Zealand, Australia (though the "bronze whaler fishery" of Western Australia actually takes mostly dusky sharks), South Africa, Brazil, Uruguay, Argentina, Mexico, and China; it also contributes to the bycatch of other commercial fisheries across its range. This species is caught in gillnets and on bottom longlines, and to a much lesser extent in bottom trawls and on pelagic longlines.[1] The meat is sold for human consumption.[6] The copper shark is also popular with recreational fishers in Namibia, New Zealand, Australia, South Africa, Argentina, Mexico and California, predominantly by anglers but also by bowfishers and gillnetters. In New Zealand, it is the Carcharhinus species most frequently caught by sport fishers and sustains a small, summer recreational fishery in northern North Island, that mainly captures pregnant and post-partum females and for the most part practices tag and release. A tag and release program is also practiced in Namibia.[1]

Conservation[edit]

The International Union for Conservation of Nature (IUCN) has assessed the copper shark as Near Threatened worldwide. While the global population is unknown, the long maturation time and low reproductive rate of this species render it highly susceptible to overfishing. Regionally, the IUCN has listed this species under Least Concern off Australia, New Zealand, and South Africa, where fisheries are generally well-managed; the local copper shark population for each of those three countries is contained almost entirely within their respective Exclusive Economic Zones (EEZ). Reported catches by New Zealand have steadily declined from a peak of 40 tons in 1995/96 to 20 tons 2001/02, though it is uncertain whether this reflects a genuine decline or changing fishing habits.[1]

In the eastern Pacific, the copper shark is rare and little fishery information is available, leading to an assessment of Data Deficient. However, catch declines across all shark and ray species have been documented in the heavily-fished Gulf of California. Off East Asia, the copper shark has been assessed as Vulnerable; though species-specific data is unavailable, shark populations overall have been decimated in the region. The number of large adults have been too low to sustain targeted fisheries since the 1970s, and most of the current shark catch consists of small juveniles. Additional threats to this species include the degradation and destruction of its coastal nurseries from development, pollution, and aquaculture, mortality from shark nets used to protect beaches in South Africa and Australia, and persecution by fish farmers in southern Australia.[1]

References[edit]

  1. ^ a b c d e f g h i j k l m n o p q r s t u Duffy, C. and I. Gordon (2003). "Carcharhinus brachyurus". IUCN Red List of Threatened Species. Version 2010.1. International Union for Conservation of Nature. Retrieved April 17, 2010. 
  2. ^ Compagno, L.J.V., M. Dando and S. Fowler (2005). Sharks of the World. Princeton University Press. pp. 292–293. ISBN 978-0-691-12072-0. 
  3. ^ "Carcharhinus brachyurus (Bronze Whaler, Cocktail Shark, Copper Shark, Narrowtooth Shark, New Zealand Whaler), ICUN Red List of Threatened Species". International Union for Conservation of Nature and Natural Resources. No estimates of population size or biomass are available. Global population structure is unknown. Stock structure is not known for any fished population. 
  4. ^ a b "ISAF Statistics on Attacking Species of Shark". Florida Museum of Natural History, University of Florida. Retrieved 6 April 2014. 
  5. ^ a b Günther, A.C.L.G. (1870). Catalogue of the Fishes in the British museum, Volume 8. The Trustees. p. 369. 
  6. ^ a b c d e f g h Ebert, D.A. (2003). Sharks, Rays, and Chimaeras of California. University of California Press. pp. 149–152. ISBN 0-520-23484-7. 
  7. ^ a b c d e f g Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Food and Agricultural Organization of the United Nations. pp. 464–466. ISBN 92-5-101384-5. 
  8. ^ a b c Ferrari, A. and A. Ferrari (2002). Sharks. Firefly Books. pp. 164–165. ISBN 1-55209-629-7. 
  9. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2010). "Carcharhinus brachyurus" in FishBase. April 2010 version.
  10. ^ a b c Garrick, J.A.f. (1982). Sharks of the genus Carcharhinus. NOAA Technical Report, NMFS Circ. 445: 1–194.
  11. ^ Compagno, L.J.V. (1988). Sharks of the Order Carcharhiniformes. Princeton University Press. pp. 319–320. ISBN 0-691-08453-X. 
  12. ^ Naylor, G.J.P. (1992). "The phylogenetic relationships among requiem and hammerhead sharks: inferring phylogeny when thousands of equally most parsimonious trees result". Cladistics 8 (4): 295–318. doi:10.1111/j.1096-0031.1992.tb00073.x. 
  13. ^ Heim, B. and J. Bourdon (January 27, 2009). Fossil species: Carcharhinus brachyurus. The Life and Times of Long Dead Sharks. Retrieved on April 11, 2010.
  14. ^ Marsili, S. (March 2007). "Revision of the teeth of the genus Carcharhinus (Elasmobranchii; Carcharhinidae) from the Pliocene of Tuscany, Italy". Rivista Italiana di Paleontologia e Stratigrafia 113 (1): 79–95. 
  15. ^ Long, D.J. (May 24, 1993). "Preliminary list of the marine fishes and other vertebrate remains from the Late Pleistocene Palos Verdes Sand Formation at Costa Mesa, Orange County, California". Paleobios 15 (1–4): 9–13. 
  16. ^ a b c Walter, J.P. and D.A. Ebert (1991). "Preliminary estimates of age of the bronze whaler Carcharhinus brachyurus (Chondrichthyes: Carcharhinidae) from southern Africa, with a review of some life history parameters". South African Journal of Marine Science 10: 37–44. doi:10.2989/02577619109504617. 
  17. ^ a b c Hennemann, R.M. (2001). Sharks & Rays: Elasmobranch Guide of the World. IKAN-Unterwasserarchiv. p. 133. ISBN 3-925919-33-3. 
  18. ^ a b Van der Elst, R. (1993). A Guide to the Common Sea Fishes of Southern Africa (third ed.). Struik. p. 35. ISBN 1-86825-394-5. 
  19. ^ a b Last, P.R. and J.D. Stevens (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. pp. 254–255. ISBN 0-674-03411-2. 
  20. ^ Dianne J. Bray, 2011, Bronze Whaler, Carcharhinus brachyurus, in Fishes of Australia, accessed 26 Aug 2014, http://www.fishesofaustralia.net.au/home/species/2883
  21. ^ a b c Press, M. Biological Profiles: Narrowtooth Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on April 18, 2010.
  22. ^ Schmidt, G.D. and I. Beveridge (June 1990). "Cathetocephalus australis n. sp. (Cestoidea: Cathetocephalidae) from Australia, with a Proposal for Cathetocephalidea n. ord". The Journal of Parasitology (The American Society of Parasitologists) 76 (3): 337–339. doi:10.2307/3282661. JSTOR 3282661. 
  23. ^ Beveridge, I. and R.A. Campbell (February 1993). "A revision of Dasyrhynchus Pintner (Cestoda: Trypanorhyncha), parasitic in elasmobranch and teleost fishes". Systematic Parasitology 24 (2): 129–157. doi:10.1007/BF00009597. 
  24. ^ Richmond, C. and J.N. Caira (May 1991). "Morphological investigations into Floriceps minacanthus (Trypanorhyncha: Lacistorhynchidae) with analysis of the systematic utility of scolex microtriches". Systematic Parasitology 19 (1): 25–32. doi:10.1007/bf00010299. 
  25. ^ Caira, J.N., C. Richmond and J. Swanson (October 2005). "A revision of Phoreiobothrium (Tetraphyllidea : Onchobothriidae) with descriptions of five new species". Journal of Parasitology 91 (5): 1153–1174. doi:10.1645/GE-3459.1. PMID 16419764. 
  26. ^ Campbell, R.A. and I. Beveridge (1993). "New species of Grillotia and Pseudogrillotia (Cestoda: Trypanorhyncha) from Australian sharks, and definition of the family Grillotiidae Dollfus, 1969". Transactions of the Royal Society of South Australia 117 (1–2): 37–46. 
  27. ^ Soto, J.M.R. (November 2000). "Marine leech, Stibarobdella macrothela (Schmarda, 1861) (Hirudinea, Piscicolidae), parasitic on the whaler shark, Carcharhinus brachyurus (Gunther, 1870) (Chondrichthyes, Carcharhinidae), in southern Brazilian waters". Revista Brasileira de Biologia 60 (4): 713–714. doi:10.1590/S0034-71082000000400024. 
  28. ^ a b Smale M.J. (1991). "Occurrence and feeding of three shark species, Carcharhinus brachyurus, C. obscurus and Sphyrna zygaena, on the Eastern Cape coast of South Africa". South African Journal of Marine Science 11: 31–42. doi:10.2989/025776191784287808. 
  29. ^ Heithaus, M.R. (January 2001). "Predator-prey and competitive interactions between sharks (order Selachii) and dolphins (suborder Odontoceti): a review". Journal of Zoology 253: 53–68. doi:10.1017/S0952836901000061. 
  30. ^ a b c Cliff, G. and S.F.J. Dudley (1992). "Sharks caught in the protective gill nets off Natal, South Africa. 6. The copper shark Carcharhinus brachyurus (Günther)". South African Journal of Marine Science 12: 663–674. doi:10.2989/02577619209504731. 
  31. ^ Pescak, T.P. (2005). Currents of Contrast: Life in Southern Africa's Two Oceans. Struik. p. 122. ISBN 1-77007-086-9. 
  32. ^ Lamberth, S.J. (November 2006). "White shark and other chondrichthyan interactions with the beach-seine (treknet) fishery in False Bay, South Africa". African Journal of Marine Science 28 (3–4): 723–727. doi:10.2989/18142320609504222. 
  33. ^ a b c d Lucifora, L.O., R.C. Menni and A.H. Escalante (2005). "Reproduction and seasonal occurrence of the copper shark, Carcharhinus brachyurus, from north Patagonia, Argentina". ICES Journal of Marine Science 62 (1): 107–115. doi:10.1016/j.icesjms.2004.09.003. 
  34. ^ Anna Leask; Kieran Campbell; Andrew Koubaridis (Feb 27, 2013). "Shark victim named". New Zealand Herald. He spoke of the concern he held for his friends when he saw a large bronze whaler shark, assuming his wife was already safely ashore. 
  35. ^ Leask, A., K. Campbell, and A. Koubaridis (February 27, 2013). "Shark Victim Named". NZ Herald. Retrieved April 10, 2014. 
  36. ^ "Shark Victim Named". NZ Herald. A DECADE OF SHARK ATTACKS IN NZ 
  37. ^ Rickard, L. (September 5, 2011). "Shark attack witness tells of mauling horror". The Sydney Morning Herald. Retrieved September 5, 2011. 
  38. ^ Burgess, George. "ISAF Statistics on Attacking Species of Shark". International Shark Attack File Florida Museum of Natural History, University of Florida. Retrieved 12 April 2014. Positive identification of attacking sharks is very difficult since victims rarely make adequate observations of the attacker during the "heat" of the interaction. Tooth remains are seldom found in wounds and diagnostic characters for many requiem sharks (family Carcharhinidae) are difficult to discern even by trained professionals. That said, this list must be used with caution because attacks involving easily identified species, such as white, tiger, sandtiger, hammerhead and nurse sharks, nearly always identify the attacking species, while cases involving difficult to identify species, such as requiem sharks of the genus Carcharhinus, seldom correctly identify the attacker. Thus the list is skewed to readily identified species. 
  39. ^ "ISAF Statistics on Attacking Species of Shark". International Shark Attack File Florida Museum of Natural History, University of Florida. Retrieved 12 April 2014. A number of requiem sharks in the genus Carcharhinus likely are involved in many more attacks than they are credited in this list and, if the list could reflect that reality, Carcharhinus bites would push such species as the sandtiger, hammerhead and nurse sharks towards the bottom of the list. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!