Overview

Comprehensive Description

Description

  Common names: anchovy (English), anchoa (Espanol)
 
Anchoa compressa (Girard,1858)

Deep body anchovy



Body moderately deep, compressed; snout pointed, ½-¾ of eye diameter long; top jaw medium length, not reaching rear of preopercle, tip blunt; membrane between gill covers not expanded at rear; third gill arch with a few short rakers on its rear face; 21-24 lower gill rakers; no large canine teeth; dorsal fin origin in mid-body; anal fin base long, 27-31 rays, origin just before middle of dorsal fin; pectorals long, reaching base of pelvics.



Bright silver stripe along flank often as wide as eye, not fading in death.

Size: 16.5 cm.

Habitat: marine, coastal pelagic, most commonly found in bays.

Depth: 0-18.5 m.

Point Conception, California to Magdalena Bay, Baja California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A schooling species most commonly found in bays and inlets (the fourth most abundant fish taken by various gear in Newport Bay, California; its eggs are the most abundant of 7 species sampled, especially in May). The ovarian eggs are spherical. Eggs and larvae are planktonic (Ref. 35602). Feeds on plankton (Ref. 8593). Basically filter-feeders, but at times have been observed feeding by selection (Ref. 4930). Normally used as bait (Ref. 9298).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 0 (G) - 18 (G)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Central Pacific: Morro Bay, California (Ref. 2850) to Magdalena Bay, Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 16.5 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Analspines: 0; Analsoft rays: 27 - 34
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 133 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

13.3 cm SL (male/unsexed; (Ref. 9298)); max. reported age: 6 years (Ref. 72482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Moderately deep. Snout pointed, about 1/2 to 3/4 eye diameter; maxilla moderate, tip rather blunt, not reaching to hind border of pre-operculum; pseudobranch short, covered by skin; gill cover canals of panamensis-type. Anal fin origin a little before midpoint of dorsal fin base. A bright silver stripe along flank, often as wide as eye, not fading on preservation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Surface, Near Surface, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-neritic; brackish; marine; depth range 0 - 50 m (Ref. 189)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1.25 - 265

Graphical representation

Depth range (m): 1.25 - 265
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Planktivore

Diet: phytoplankton, zooplankton, pelagic fish eggs, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 35602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anchoa compressa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTTATTTTTGGTGCCTGAGCAGGAATAGTGGGGACAGCACTTAGCCTCCTTATTCGGGCAGAATTAAGCCAACCAGGAGCACTTCTGGGAGACGATCAAATTTATAATGTAATCGTGACTGCCCACGCATTCGTAATAATCTTTTTCATGGTAATGCCCATCTTAATCGGTGGGTTCGGGAATTGACTGGTTCCTTTAATACTAGGAGCCCCAGATATAGCATTCCCCCGAATGAACAACATAAGCTTTTGGCTGCTTCCTCCCTCGTTCCTTCTACTTCTCGCATCGTCTGGTGTTGAGGCGGGAGCTGGGACAGGGTGAACAGTATACCCGCCTCTAGCGGGAAACCTCGCCCACGCTGGAGCATCAGTAGACTTAACGATCTTTTCTCTTCACCTGGCAGGGATTTCATCAATTCTAGGTGCCATTAATTTTATTACTACCATCATTAACATGAAACCACCTGCCATTTCACAATACCAGACACCTCTATTTGTCTGAGCTGTGCTAATCACGGCAGTACTTTTACTTCTTTCCCTCCCCGTTCTAGCTGCTGGAATTACTATGCTTCTCACAGATCGAAACCTTAACACCACCTTCTTCGATCCAGCAGGGGGAGGAGACCCAATTCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anchoa compressa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!