Articles on this page are available in 1 other language: Arabic (18) (learn more)

Overview

Brief Summary

Description

A prehistoric-looking fish, the Yangtze sturgeon has a long and slender body covered with rough skin and bony plates. A pointed snout extends from the triangular head and two pairs of barbels hang from the lower jaw. The upper side of the body varies from dark yellow through brown to dark grey, and this fades to milky white on the underside (4). Juveniles have a black body and tail with a light grey line running from head to tail (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

This nocturnal fish undertakes regular migrations, and after becoming sexually mature at seven to eight years old, it swims upstream during the spring floods each year to spawn. A large number of sticky eggs are produced, which adhere securely to stones on the riverbed (4). From hatching to around three weeks old, the tiny juveniles remain close to the river bottom, feeding on zooplankton and hiding from predators. Once they reach 10 to 11 weeks old, they are large enough to migrate downstream to join the adults (5). Older Yangtze sturgeon consume small fish and aquatic plants (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

Endemic Range/ Yangtze River Basin

Acipenser dabryanus is an endangered demersal fish found in portions of the Yangtze River Basin, previously inhabitating even greater extents of the basin. The upper Yangtze basin is considered the part from the headwaters to the Three Gorges area, or a catchment area of approximately one million square kilometers; this upper basin is quite mountainous. The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The highest elevation ecoregion of the Yangtze Basin is the uppermost reach or headwaters catchment area of the Yangtze, known as the Tibetan Plateau alpine shrub and meadows.

The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Construction of this dam without adequate biotic mitigation has resulted in considerable aquatic habitat degradation and decline of native fish populations.

The demersal fish Silurus meridionalis also is found as a middle reach Yangtze River endemic species. Some of the notably large native demersal fish occurring in the Yangtze Basin are the 120 centimeter (cm) long Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus) and the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Asia: China in Yangtze River system (Ref. 4537) and Korea (Ref. 12218). Endangered, close to extinction (Ref. 6866). International trade restricted (CITES II, since 1.4.98).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yangtze River basin, China and Korea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Endemic to the Yangtze River, China (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 40 - 49; Analspines: 0; Analsoft rays: 27 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

250 cm TL (male/unsexed; (Ref. 38401))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Snout short and pointed; lips with small papilla; barbels 2 pairs and situated in belly of snout; body covered with 5 rows of ganoid scales and skin between scales rough (Ref. 45563).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Yangtze River Demersal Habitat

This taxon is one of a number of demersal species in the Yangtze River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton.

The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Prior to construction of the dam, the Three Gorges area was a site of exceptional natural beauty; after dam construction the gorge areas were filled with approximately 100 meters in depth of Yangtze water, and considerable amounts of the watershed were graded.

The lower Yangtze basin consists of anabranching river structures and Pleistocene coastal terraces. Prior to development of the Three Gorges Dam, the Yangtze Delta was replenished with a copious sediment load reaching the river mouth; however, the dam has now severely limited the natural flow and deposition of sediment to the delta region. Consequently, the integrity of the delta is been compromised, with scouring exceeding deposition, and the very stability of the delta is endangered.

Lower and middle basins of the Yangtze carry heavy pollutant loads. In the lower Yangtze basin nitrate levels are high, measuring at about 1000 tons per day at Datong; these levels accrue from high applications of chemical fertilizer applied and also considerable loadings of untreated sewage due to the large human population of the basin, with correspondingly little infrastructure for sewage treatment.

Heavy metal concentrations are also high in the lower Yangtze, with measurements of dissolved lead at 0.078 microgram/liter; cadmium (0.024 microgram/liter), chromium (0.57 microgram/liter), copper (1.9 microgram/liter), and nickel (0.50 microgram/liter). Levels of dissolved arsenic have been measured at 3.3 microgram/liter) and zinc at 1.5 microgram/liter), both notably higher by factors of 5.5 and 2.5 respectively than other typical large world rivers. In Yangtze River suspended sediment, arsenic comprises 31 microgram/gram, lead comprises 83 microgram/gram, and nickel comprises 52 micrograms/gram of sediment content

There are several large native demersal fish found in the Yangtze River, chiefly the 250 centimeter (cm) long endangered Yangtze sturgeon (Acipenser dabryanus), the 120 cm Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus), the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis. Furthermore, there are a few exceptionally large native benthopelagic fishes found in the Yangtze, namely, the 105 cm Silver carp (Hypophthalmichthys molitrix), the 200 cm Wuchang bream (Megalobrama amblycephala), the 200 cm yellowcheek (Elopichthys bambusa), the 145 cm common carp (Cyprinus carpio carpio), the 122 cm Mongolian redfin (Chanodichthys mongolicus), the 102 cm predatory carp (Chanodichthys erythropterus) and the 100 cm snakehead (Channa argus argus).. The demersal fish Silurus meridionalis also is found as a Yangtze River endemic species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater, usually 8 - 10 m (Ref. 93286)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Yangtze sturgeon is found in a variety of freshwater habitats, away from the riverbank in water eight to ten metres deep. Adults appear to prefer regions with a sandy silt bottom, and young stay in sandy shallows (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits the middle and lower reaches of rivers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acipenser dabryanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGTTGATTCTTTTCTACTAACCACAAAGATATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCTTGCTTGGCGAT---GACCAGATCTACAATGTTATCGTTACAGCCCACGCCTTTGTCATGATTTTCTTTATAGTAATACCCATCATAATTGGCGGATTCGGAAACTGACTGGTCCCCCTAATAATTGGAGCCCCAGACATGGCATTCCCTCGTATGAACAATATGAGCTTCTGGCTCCTACCCCCATCCTTCCTACTCCTTCTGGCCTCCTCTGGGGTAGAGGCCGGGGCCGGCACAGGATGAACTGTTTACCCCCCACTGGCGGGAAACCTGGCCCATGCAGGAGCCTCTGTAGACCTAACCATTTTCTCCCTCCACCTGGCCGGGGTATCGTCCATTTTAGGAGCTATTAATTTTATCACCACAATTATTAACATGAAACCCCCCGCAGTATCCCAATACCAGACACCTCTATTTGTATGATCTGTATTAATCACGGCCGTGCTTCTCCTGCTGTCACTGCCAGTGCTAGCTGCGGGGATCACAATACTTCTAACAGATCGAAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTCTACCAACACCTATTTTGATTCTTTGGCCACCCAGAGGTGTACATTCTAATTCTACCAGGATTCGGCATGATCTCCCACATTGTAGCCTACTATGCCGGCAAAAAAGAACCTTTTGGCTATATAGGAATAGTGTGGGCCATAATGGCTATTGGACTACTAGGCTTTATCGTGTGAGCTCATCACATATTTACAGTTGGAATGGACGTAGACACACGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acipenser dabryanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status

The Yangtze sturgeon is classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and is listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Critically Endangered (CR) (A2bcd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Yangtze sturgeon is at risk from over-fishing, pollution, and habitat degradation and loss. An important factor in its decline was the construction of the Gezhouba Dam across the Yangtze River at Yichang in Hubei Province in 1981. As this prevented upstream migration necessary for spawning, the Yangtze sturgeon is now only found above the dam (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation of this fish is now urgent, with emphasis needed on habitat protection, capture control and stock replenishment. This sturgeon species spawns earlier in life than most sturgeons, and therefore has aquaculture potential for caviar production. Controlled production of the Yangtze sturgeon could both reduce fishing levels and allow reintroductions of fish back into the river (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dabry's sturgeon

Dabry's sturgeon (Acipenser dabryanus) is a species of fish in the sturgeon family, Acipenseridae. Other common names include Yangtze sturgeon, Chiangjiang sturgeon, and river sturgeon.[2] It is endemic to the Yangtze River Basin in China. It was a food fish of commercial importance. Its populations declined drastically, and in the early 1980s, it was designated an endangered species and commercial harvest was banned.[2] It has been listed as a critically endangered species by the IUCN since 1996 and since 2010 (possibly extinct) has been added to its status.[1]

This sturgeon has been known to reach 2.5 m in length, but it is usually much smaller.[3] Its body is blue-gray above and yellowish white on the belly, with five rows of scutes. The head is triangular and the snout is long with the mouth located on the underside. There are two pairs of barbels.[4]

The fish lives in slow-moving river waters over substrates of sand and mud. It feeds on aquatic plants, invertebrates, and small fish. This species is potamodromous, taking part in a migration, but never leaving fresh water.[4] It spawns in the upper Yangtze, mainly during March and April, and sometimes around November and December. Males spawn each year, but most females do not. The female produces 57,000 to 102,000 eggs.[4]

This was once a common fish in the Yangtze system.[4] It was known from the main river and some of its larger tributaries, as well as some lakes attached to the system. By the late 20th century, it was extirpated from the lower river and limited to the upper reaches in Sichuan. The main causes of its drastic decline include overfishing, including the overharvesting of juveniles. The construction of dams, such as the Three Gorges Dam, blocked the movement of the fish along the river, restricting it to the upper reaches. It also caused habitat fragmentation and degradation. Increased development and deforestation on land near the river has increased pollution from wastewater and runoff.[1]

The fish has been bred in captivity since the 1970s. Thousands of individuals have been released into the river, but are apparently not breeding. Nevertheless, this restocking may be the only effort preventing the extinction of the species.[1]

See also[edit]

References[edit]

  1. ^ a b c d Qiwei, W. 2010. Acipenser dabryanus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. Downloaded on 15 October 2013.
  2. ^ a b Zhuang, P., et al. (1997). Biology and life history of Dabry's sturgeon, Acipenser dabryanus, in the Yangtze River. Environmental Biology of Fishes 48(1-4), 257-64.
  3. ^ Froese, R. and D. Pauly. (Eds.) Acipenser dabryanus. FishBase. 2011.
  4. ^ a b c d Gao, X., et al. (2009). Threatened fishes of the world: Acipenser dabryanus Duméril, 1869. Environmental Biology of Fishes 85(2), 117-18.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!