Overview

Comprehensive Description

Biology

More often in silty reef areas than in rich coral growth (Ref. 30573). Minimum depth reported taken from Ref. 9710.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: Red Sea, Persian Gulf and Gulf of Oman to at least 13°S (Ref. 10629). Mediterranean (Ref. 96519).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Western Indian Ocean: East Africa and Gulf of Aden to Persian Gulf (Arabian Gulf); Mediterranean Sea immigrant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 21; Analspines: 3; Analsoft rays: 19 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 500 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm SL (male/unsexed; (Ref. 30573))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits coral reefs.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits coral reefs.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 3 - 55.5
  Temperature range (°C): 25.240 - 28.720
  Nitrate (umol/L): 0.004 - 0.862
  Salinity (PPS): 37.566 - 39.733
  Oxygen (ml/l): 4.314 - 4.482
  Phosphate (umol/l): 0.277 - 0.282
  Silicate (umol/l): 0.966 - 3.015

Graphical representation

Depth range (m): 3 - 55.5

Temperature range (°C): 25.240 - 28.720

Nitrate (umol/L): 0.004 - 0.862

Salinity (PPS): 37.566 - 39.733

Oxygen (ml/l): 4.314 - 4.482

Phosphate (umol/l): 0.277 - 0.282

Silicate (umol/l): 0.966 - 3.015
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 4 - 50 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 3 - 55.5
  Temperature range (°C): 25.240 - 28.720
  Nitrate (umol/L): 0.004 - 0.862
  Salinity (PPS): 37.566 - 39.733
  Oxygen (ml/l): 4.314 - 4.482
  Phosphate (umol/l): 0.277 - 0.282
  Silicate (umol/l): 0.966 - 3.015

Graphical representation

Depth range (m): 3 - 55.5

Temperature range (°C): 25.240 - 28.720

Nitrate (umol/L): 0.004 - 0.862

Salinity (PPS): 37.566 - 39.733

Oxygen (ml/l): 4.314 - 4.482

Phosphate (umol/l): 0.277 - 0.282

Silicate (umol/l): 0.966 - 3.015
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 50m.
From 4 to 50 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus maculosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATTTACTATTTGGTGCCTGAGCCGGAATGGTAGGCACAGCTTTAAGCCTGCTAATCCGAGCCGAACTAAACCAACCAGGTAGCCTTCTCGGAGACGACCAGATCTATAATGTAATTGTTACAGCACACGCATTTGTAATAATCTTTTTTATAGTAATGCCAGCTATGATTGGAGGTTTCGGGAACTGATTGGTTCCACTGATAATTGGAGCCCCAGACATGGCATTCCCCCGAATAAACAATATAAGCTTTTGGCTCTTACCCCCTTCCCTCCTCCTCCTTCTTGCTTCCGCTGGAGTAGAAGCCGGAGCCGGAACTGGGTGAACAGTTTACCCGCCCCTAGCCGGTAATTTAGCCCATGCAGGAGCATCCGTAGACTTAACCATTTTCTCCCTCCATCTGGCCGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATTACAACTATTATTAATATAAAACCTCCCGCTATCTCACAATACCAAACTCCACTGTTTGTGTGGGCCGTCCTGATTACTGCAGTATTACTTCTTCTCTCCCTCCCCGTCCTTGCCGCTGGCATTACTATGCTTCTCACAGACCGAAATTTAAACACTACTTTTTTCGACCCTGCAGGAGGCGGAGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus maculosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pomacanthus maculosus

Pomacanthus maculosus is a marine angelfish distributed throughout the Persian Gulf, the northwestern Indian Ocean, and the Red Sea. Its common names include halfmoon angelfish, yellowband angelfish, yellowbar angelfish, yellow-blotch angelfish, and yellow-marked angelfish.[1] The species lives mainly in coral and rocky areas, in shallow to moderate depths (forty feet), though it is more often in silty reef areas than in rich coral growth. It occasionally makes its way into the aquarium trade.

Juveniles have different markings than adults.

Appearance[edit]

This angelfish grows to a size of 50 cm in length. It is very similar in appearance to the asfur angelfish (P. asfur), which is found in overlapping habitats in the Persian Gulf and Red Sea. The halfmoon angelfish can be distinguished from the asfur primarily by its tail color, which is pale to clear, while the asfur's tail is bright yellow.

As with other large angelfish in genus Pomacanthus, juveniles and sub-adults are differently marked and colored than adults. Small halfmoon angelfish are alternately blue, white, and black banded.

Diet[edit]

This species has a diet typical of angelfishes. Its main food is sponges. It also eats small anemones, algae, tubeworms, and shrimp.

Notes[edit]

  1. ^ Pyle, R., et al. 2010. Pomacanthus maculosus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 05 June 2013.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!