Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

<i>Sphyrna mokkaran</i>

The Great Hammerhead Shark (Sphyrna mokkaran) taxonomy :

Filum : Chordata

Class : Chondricthys

Ordo : Charcarinifer

Famili : Sphyrinidae

Genus : Sphyrna

Species : Sphyrna mokkaran

The great Hammerhead Shark (Sphyrna mokarran), one species of Sphyrninidae that have the largest size of body usually founded in the warm water especially on the warm temperate ocean around the world like Pacific and Hindia ocean. This species can we found on the lagoon, coral reef, embayment, coastal water, sea mount, and island chain. They also found on the schooling but not on the large schooling scale.

The hammerhead shark commonly observed from coastal water to continental shelf and at depth ranging from 1m to 300m under the sea surface. They are high migratory species and nomadic. They distribution area such as Andaman Sea, Arabian sea, East china sea, Indonesia sea, gulf of Mexico,

Mediteranian sea, etc.

Like the other species of shark, the hammerhead shark is one of top predator on the coastal ecosystem that need a good condition for the live. They diet includes demersal fish (prefer), crustacea, otherelasmobranchs, and chepalopods. Grouper and catfish also the prefer food for great hammerhead shark.

Today, the great hammerhead shark is one of shark species commonly targeted for their large ddorsal and tail fins which are highly valued on Asian fish market. The impact for this condition is decreasing

population of great hammershark. IUCN give ENDENGARED status for this species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: Ferdy Gustian

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The great hammerhead is particularly keen on feeding on stingrays, despite the danger of their barbs. The hammerhead pins down each ray with its hammer and then bites chunks from the wings until the ray is immobilised (4). It also feeds on groupers, sea catfish, small, bony fish, crabs, squid, other sharks and lobsters (2). It can be cannibalistic although it is not known what triggers this behaviour. Feeding mainly at dusk, the great hammerhead uses an electro-sensory system to locate prey; sensing the weak electric field produced by all living organisms. Larger sharks may prey on juvenile great hammerheads but adults have no natural predators (3). Mating has rarely been observed in this species, but unlike other sharks it is known to mate at the surface (3). Males use extensions of the pelvic fins called 'claspers' to transfer sperm to the female (5), resulting in a pregnancy lasting 11 months (3). Young are born live in the spring or summer (3). The function of the hammer is much discussed and a great many theories have been put forward as to its purpose. Amongst these theories, the most popular are that it helps the shark to scan larger areas of the ocean floor for food, and that it maximises the area of the sensory organs (known as the ampullae of Lorenzini) that can detect chemical, physical and thermal changes in the water, as well as electric fields (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This massive and well-known shark has the most distinctive hammer of its genus. It is particularly wide and virtually straight along the front edge, with just a small notch in the centre. The eyes are at either end of the hammer and the mouth is positioned on the underside in line with the trail edge of the hammer. The first dorsal fin is particularly tall, sickle-shaped and has a pointed tip. The second dorsal fin is also tall with a concave rear edge. The body is dark grey above fading to light grey below. The teeth are triangular and strongly serrated. Juveniles are similar but have a more curved hammer (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: hammerhead (English), shark (English), tiburón (Espanol)
 
Sphyrna mokarran (Rüppell, 1837)


Great hammerhead,     Great hammerhead shark


A hammerhead shark with broad, narrow-blade side extensions on the head forming a hammer (width 23-27% of TL); front margin of head nearly straight in adults, with shallow central and side indentations; front teeth blade-like, with 1 point, lower teeth straight, upper teeth oblique, deeply notched on rear side; rear teeth like front teeth; first dorsal fin very tall and curved, with pointed tip; second dorsal fin large, height > length of 3rd  gill slit; second dorsal and anal fins with strongly notched rear edges, their bases about equal; pelvics large, with concave rear borders; transverse pit above tail base crescent shaped, a pit below tail base; tail fin strongly asymmetrical, notched under tip of top lobe, large lower lobe.

Grey brown on back and sides, whitish below; no prominent markings on fins.

Said to reach 610 cm and 450kg, but uncommon above 350 cm; size at birth 50-70 cm.

A coastal pelagic and semi- oceanic species.

Depth range 1-300 m.

Circumtropical distribution, in the eastern Pacific from southern Baja California and the Gulf of California to northern Peru, Malpelo and the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A coastal-pelagic, semi-oceanic shark, found close inshore and well offshore, over the continental shelves, island terraces, and in passes and lagoons (Ref. 244, 58302). Often bottom and reef associated at 1-80 m (Ref. 58302). Prefers to feed on stingrays and other batoids, groupers and sea catfishes, but also preys on other small bony fishes, crabs, squid, other sharks, rays, and lobsters (Ref. 244, 13562, 1602). A viviparous species, with 13-42 of about 56 to 70 cm young in a litter (Ref. 26938, 1602). Potentially dangerous to people (Ref. 13562) but only few, if any, of the attacks on people can be definitely attributed to it because of the apparent difficulty of distinguishing large hammerhead species involved in attacks (Ref. 244). Caught occasionally by target shark longline, demersal tangle net and tuna gillnet fisheries (Ref.58048). Meat utilized for human consumption (fresh, fresh-frozen, dried-salted, and smoked), liver oil for vitamins, fins for soup, hides for leather, and carcasses for fishmeal (Ref. 244). Its large fins, including the tail, sail-like first dorsal fin, are prized in the Oriental sharkfin trade (Ref. 47737).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 1 (S) - 300 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), West + East Pacific (but not Central), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Carolina to Uruguay (highly migratory species)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great hammerhead sharks occur in all tropical waters worldwide.

Biogeographic Regions: oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in coastal warm temperate and tropical seas (Ref. 13562). Western Atlantic: North Carolina, USA to Uruguay, including the Gulf of Mexico and Caribbean. Eastern Atlantic: Mediterranean and Morocco to Senegal. Indo-Pacific: throughout the Indian Ocean; Ryukyu Islands to New Caledonia and French Polynesia. Eastern Pacific: southern Baja California, Mexico to Peru. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Red Sea, Madagascar, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The great hammerhead is found around the world in warm temperate and tropical seas including the Atlantic, Pacific and Indian Oceans and the Mediterranean and Black Seas (1) (2). It migrates poleward during the summer in search of cooler waters (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 610.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great hammerhead sharks posses a virtually straight anterior margin of the head with a deep central indentation. They have high second dorsal fins and the pelvic fins have curved rear margins. The teeth are triangular with extraordinarily serrated edges, becoming increasingly oblique toward the corners of the mouth. Their coloration varies from deep olive green to brownish grey above and white below. They are generally 4 to 6 m in length.

Range mass: 400 to 460 kg.

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 6100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

610 cm TL (male/unsexed; (Ref. 244)); max. published weight: 449.5 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

A coastal-pelagic, semi-oceanic shark, found close inshore and well offshore, over the continental shelves, island terraces, and in passes and lagoons. Nomadic and migratory. Feeds on small bony fishes, crabs and squid, also on other sharks, rays, and lobsters. Viviparous, with 13 to 38 young in a litter. Size at birth 50 to 70 cm. Potentially dangerous. Meat utilized for human consumption, liver oil for vitamins, fins for soup, and hides for leather.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A very large hammerhead also with a notch at the center of the head (Ref. 5578). Front margin of head gently curved in juveniles, becoming nearly straight in adults, with slight median notch (Ref. 26938). 1st dorsal fin very high and curved; 2nd dorsal and pelvic fins high and with deeply concave rear margins. Light grey or grey-brown above, white below; fins without conspicuous markings (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 0 - 1750
  Temperature range (°C): 3.860 - 27.331
  Nitrate (umol/L): 0.171 - 29.210
  Salinity (PPS): 34.006 - 36.580
  Oxygen (ml/l): 3.107 - 6.104
  Phosphate (umol/l): 0.083 - 1.926
  Silicate (umol/l): 0.380 - 23.528

Graphical representation

Depth range (m): 0 - 1750

Temperature range (°C): 3.860 - 27.331

Nitrate (umol/L): 0.171 - 29.210

Salinity (PPS): 34.006 - 36.580

Oxygen (ml/l): 3.107 - 6.104

Phosphate (umol/l): 0.083 - 1.926

Silicate (umol/l): 0.380 - 23.528
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Mid Water, Near Bottom, Bottom

Habitat: Reef (rock &/or coral), Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found at depths of 1 - 300m.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These sharks are found in both open ocean and shallow coastal waters. During summer they may make small migrations towards more northerly areas.

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 1 - 300 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 0 - 1750
  Temperature range (°C): 3.860 - 27.331
  Nitrate (umol/L): 0.171 - 29.210
  Salinity (PPS): 34.006 - 36.580
  Oxygen (ml/l): 3.107 - 6.104
  Phosphate (umol/l): 0.083 - 1.926
  Silicate (umol/l): 0.380 - 23.528

Graphical representation

Depth range (m): 0 - 1750

Temperature range (°C): 3.860 - 27.331

Nitrate (umol/L): 0.171 - 29.210

Salinity (PPS): 34.006 - 36.580

Oxygen (ml/l): 3.107 - 6.104

Phosphate (umol/l): 0.083 - 1.926

Silicate (umol/l): 0.380 - 23.528
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 80m.
Recorded at 80 meters.

Habitat: pelagic. Great hammerhead.  (Ruppell, 1837)  Vivaparous; 20 pups per litter. Attains 5 metres. May be angerous to man. In tropical waters on our east coast, extending south to Natal; ranges widely in tropical seas, both inshore and over deep water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferring warm temperate and tropical waters, the great hammerhead is usually found close inshore, particularly around reefs, but may also found some distance offshore to depths of 300 metres (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The great hammerhead can be found around the world in tropical waters such as the Atlantic, Pacific and Indian Oceans, and smaller seas like the Mediterranean, the Black Sea, and the Arabian Gulf. The great hammerhead migrates poleward during the summer in search of cooler waters.

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Lindsay Pickering

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, bony fishes, sharks/rays
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great hammerhead sharks feed on rays, smaller sharks, and many species of bony fishes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs on the continental shelf (Ref. 75154). Inhabits coral reefs (Ref. 58534).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Sphyrna mokarran preys on:
Myliobatidae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on stingrays and other batoids, groupers and sea catfishes, but also preys on other small bony fishes, crabs, squid, other sharks, rays, and lobsters
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Viviparous with a yolk sac placenta and 13-42 young in a litter (Ref. 244); 6-42 pups after gestation period of ~11 months (Ref.58048). Size at birth between 50 to 70 cm TL (Ref.58048, Ref. 13562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great Hammerhead sharks are viviparous. At a length of 3m, maturity is reached. Litters are made up of between 20 and 40 pups. Young are born in the summer season and are approximately 70 cm in length. Head shape of a newborn pup is more rounded than that of an adult but this changes as they grow.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating has not been that observed in this species, but unlike other sharks the great hammerhead is known to mate at the surface. Males use extensions of the pelvic fins called ‘claspers’ to transfer sperm to the females. The pregnancy’s last 11 months, and then the young are born live in the spring or summer.

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Lindsay Pickering

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyrna mokarran

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 38 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTTTTAATTCGAGCTGAACTTGGGCAACCAGGATCCCTTTTAGGAGATGATCAGATTTACAATGTAATTGTAACCGCCCACGCTTTCGTAATAATCTTTTTTATGGTAATGCCAATTATAATTGGTGGTTTTGGGAATTGACTAGTTCCTTTAATAATTGGTGCACCAGATATAGCTTTCCCACGAATAAATAACATAAGCTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTAGCTTCTGCTGGAGTAGAAGCTGGAGCAGGCACTGGCTGAACAGTCTATCCTCCATTAGCTAGCAACCTAGCTCATGCTGGACCATCCGTTGATCTAGCCATCTTCTCTCTCCACTTAGCTGGTATCTCATCAATCCTGGCCTCAATTAATTTCATCACAACTATTATTAACATAAAACCCCCAGCTATTTCTCAATACCAAACACCATTATTTGTCTGATCTATTCTTGTAACTACTATTCTACTTCTCCTTTCACTTCCAGTCCTTGCAGCAGGAATTACAATATTACTTACAGATCGCAACCTTAATACTACATTCTTTGACCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sphyrna mokarran

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 37
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Listed, Endangered

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great hammerhead shark populations seem to be stable.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The great hammerhead is desperately in need of coordinated conservation efforts involving the management of directed fisheries and those that take this species as bycatch. Fortunately, the increasing recognition of the detrimental effects of shark finning has led to the implementation of finning bans by fishing states in the U.S.A., Australia and the European Union. Nevertheless, improved enforcement of legislation is required to prevent ongoing illegal finning activities. Bycatch limits for sharks in the South African longline fishery are also helping to conserve this imperilled species

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Lindsay Pickering

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Endangered (EN) (A2bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although not targeted specifically, once caught accidentally on longline and in drift nets, this shark is rarely returned to the water alive. It is prized for its fins for shark fin soup, as well as for its liver oil for vitamins, its skin for leather, and its meat for fishmeal (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Sharks have a poor reputation with humans although they are responsible for relatively few deaths. All nine species of hammerhead together have attacked just 21 people, resulting in two deaths in the history of the International Shark Attack File, which attempts to compile all shark attacks on record since the mid 1500s. Conservation action for sharks is generally poor, but further research into great hammerhead population numbers and trends is necessary before it is known how threatened this species is (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

These sharks are potentially dangerous to humans and cases of attacks by great hammerhead sharks have been documented.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great hammerhead sharks are classified as game fish, as are all large hammerhead sharks. Their skin is often used for leather.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great hammerhead

The great hammerhead (Sphyrna mokarran) is the largest species of hammerhead shark, belonging to the family Sphyrnidae, attaining a maximum length of 6.1 m (20 ft). It is found in tropical and warm temperate waters worldwide, inhabiting coastal areas and the continental shelf. The great hammerhead can be distinguished from other hammerheads by the shape of its "hammer" (called the "cephalofoil"), which is wide with an almost straight front margin, and by its tall, sickle-shaped first dorsal fin. A solitary, strong-swimming apex predator, the great hammerhead feeds on a wide variety of prey ranging from crustaceans and cephalopods, to bony fishes, to smaller sharks. Observations of this species in the wild suggest that the cephalofoil functions to immobilize stingrays, a favored prey. This species has a viviparous mode of reproduction, bearing litters of up to 55 pups every two years.

Although potentially dangerous, the great hammerhead rarely attacks humans. It sometimes behaves inquisitively toward divers and should be treated with respect. This shark is heavily fished for its large fins, which are extremely valuable on the Asian market as the main ingredient of shark fin soup. As a result, great hammerhead populations are declining substantially worldwide, and it has been assessed as Endangered by the International Union for Conservation of Nature (IUCN).

Taxonomy and phylogeny[edit]

The great hammerhead was first described as Zygaena mokarran in 1837 by the German naturalist Eduard Rüppell. The name was later changed to the current Sphyrna mokarran.[2] However, for many years the valid scientific name for the great hammerhead was thought to be Sphyrna tudes, which was coined in 1822 by Achille Valenciennes. In 1950, Enrico Tortonese determined that the specimens illustrated by Valenciennes were in fact smalleye hammerheads, to which the name S. tudes then applied. As the next most senior synonym, Sphyrna mokarran became the great hammerhead's valid name. The lectotype for this species is a 2.5 m (8.2 ft) long male from the Red Sea.[3]



Eusphyra blochii





Sphyrna mokarran



Sphyrna zygaena





Sphyrna lewini





Sphyrna tudes



Sphyrna media





Sphyrna tiburo



Sphyrna corona







Phylogenetic tree of hammerhead sharks.[4]

Older studies based on morphology have generally placed the great hammerhead as one of the more derived members of its family, reflecting the traditional view that cephalofoil size gradually increased over the course of hammerhead shark evolution. However, this view has been refuted by phylogenetic analyses using nuclear and mitochondrial DNA, which found that the great hammerhead and the smooth hammerhead (S. zygaena) form a clade that is basal to all other Sphyrna species. These results also show that the first hammerheads to evolve had large rather than small cephalofoils.[4][5]

Distribution and habitat[edit]

The great hammerhead inhabits tropical waters around the world, between the latitudes of 40°N and 37°S. In the Atlantic Ocean, it is found from North Carolina to Uruguay, including the Gulf of Mexico and the Caribbean Sea, and from Morocco to Senegal, and the Mediterranean Sea. It is found all along the rim of the Indian Ocean, and in the Pacific Ocean from the Ryukyu Islands to Australia, New Caledonia, and French Polynesia, and from southern Baja California to Peru.[2] It may occur off Gambia, Guinea, Mauritania, Sierra Leone, and Western Sahara, but this has not been confirmed.[1] Great hammerheads may be found from inshore waters of less than 1 m (3.3 ft) deep, to a depth of 80 m (230 ft) offshore. They favor coral reefs, but also inhabit continental shelves, island terraces, lagoons, and deep water near land. They are migratory; populations off Florida and in the South China Sea have been documented moving closer to the poles in the summer.[3]

Description[edit]

The "hammer" of the great hammerhead is wide with a distinctively straight leading edge.

The streamlined body of the great hammerhead with the expanded cephalofoil is typical of the hammerhead sharks. Adult great hammerheads can be distinguished from the scalloped hammerhead and the smooth hammerhead by the shape of the cephalofoil, which has a nearly straight front margin (as opposed to arched), with prominent medial and lateral indentations. The width of the cephalofoil is 23–27% of the body length. The teeth are triangular and strongly serrated, becoming more oblique towards the corners of the mouth. There are 17 tooth rows on either side of the upper jaw with 2–3 teeth at the symphysis (the midline of the jaw), and 16–17 teeth on either side of the lower jaw and 1–3 at the symphysis.[2]

The first dorsal fin is distinctive, being very tall and strongly falcate (sickle-shaped), and originates over the insertions of the pectoral fins. The second dorsal fin and anal fin are both relatively large, with deep notches in the rear margins. The pelvic fins are falcate with concave rear margins, in contrast to the straight-margined pelvic fins of the scalloped hammerhead. The skin is covered with closely placed dermal denticles. Each denticle is diamond-shaped, with 3–5 horizontal ridges leading to marginal teeth in smaller individuals, and 5–6 in larger ones. The great hammerhead is dark brown to light gray to olive above, fading to white on the underside. The fins are unmarked in adults, while the tip of the second dorsal fin may be dark in juveniles.[2][3]

The average great hammerhead measures up to 3.5 m (11.5 ft) long and weighs over 230 kg (500 lb). A small percentage of the population, mostly or all females, are much larger. The longest great hammerhead on record was 6.1 m (20 ft).[2][3] The heaviest known great hammerhead is a 4.4 m (14.4 ft) long, 580 kg (1,280 lb) female caught off Boca Grande, Florida in 2006. The weight of the female was due to her being pregnant with 55 near-natal pups.[6]

Biology and ecology[edit]

The great hammerhead is a solitary, nomadic predator that tends to be given a wide berth by other reef sharks. If confronted, they may respond with an agonistic display: dropping their pectoral fins and swimming in a stiff or jerky fashion.[7] Juveniles are preyed upon by larger sharks such as bull sharks (Carcharhinus leucas), while adults have no major predators.[2] Yellow jacks (Carangoides bartholomaei) have been seen rubbing themselves against the hammerhead's flanks, possibly to rid themselves of parasites.[8] Schools of pilot fish (Naucrates ductor) sometimes accompany the great hammerhead.[9] The great hammerhead is parasitized by several species of copepods, including Alebion carchariae, A. elegans, Nesippus orientalis, N. crypturus, Eudactylina pollex, Kroyeria gemursa, and Nemesis atlantica.[2]

Feeding[edit]

Stingrays are a favored prey of the great hammerhead.

An active predator with a varied diet, known prey of the great hammerhead include invertebrates such as crabs, lobsters, squid, and octopus, bony fishes such as tarpon, sardines, sea catfishes, toadfish, porgies, grunts, jacks, croakers, groupers, flatfishes, boxfishes, and porcupine fishes, and smaller sharks such as smoothhounds.[3] At Rangiroa Atoll, great hammerheads prey opportunistically on grey reef sharks (Carcharhinus amblyrhynchos) that have exhausted themselves pursuing mates.[10] The species is known to be cannibalistic.[2]

The favorite prey of the great hammerhead are rays and skates, especially stingrays. The venomous spines of stingrays are frequently found lodged inside its mouth and do not seem to bother the shark as one specimen caught off Florida had 96 spines in and around its mouth. Great hammerheads primarily hunt at dawn or dusk, swinging their heads in broad angles over the sea floor so as to pick up the electrical signatures of stingrays buried in the sand, via numerous ampullae of Lorenzini located on the underside of the cephalofoil. The cephalofoil also serves as a hydrofoil that allows the shark to quickly turn around and strike at a ray once detected.[11] Off Florida, large hammerheads are often the first to reach newly baited sharklines, suggesting a particularly keen sense of smell.[3]

Another function of the cephalofoil is suggested by an observation of a great hammerhead attacking a southern stingray (Dasyatis americana) in the Bahamas: the shark first knocked the ray to the sea bottom with a powerful blow from above, and then pinned it with its head while pivoting to take a large bite from each side of the ray's pectoral fin disc. This effectively crippled the stingray, which was then picked up in the jaws and sawed apart with rapid shakes of the head.[12] A great hammerhead has also been seen attacking a spotted eagle ray (Aetobatus narinari) in open water by taking a massive bite out of one of its pectoral fins. The ray thus incapacitated, the shark once again used its head to pin it to the bottom and pivoted to take the ray in its jaws head-first. These observations suggest that the great hammerhead seeks to disable rays with the first bite, a strategy similar to that of the great white shark (Carcharodon carcharias), and that its cephalofoil is an adaptation for prey handling.[13]

Life history[edit]

Great hammerhead embryos are connected to their mother by a placenta during gestation.

As with other hammerhead sharks, great hammerheads are viviparous: once the developing young use up their supply of yolk, the yolk sac is transformed into a structure analogous to a mammalian placenta. Unlike most other sharks, which mate on or near the sea bottom, great hammerheads have been observed mating near the surface. In one account from the Bahamas, a mating pair ascended while swimming around each other, mating when they reached the surface.[2] Females breed once every two years, giving birth from late spring to summer in the Northern Hemisphere and from December to January in Australian waters.[1] The gestation period is 11 months.[2] The litter size ranges from 6–55 pups, with 20–40 being typical.[6] The young measure 50–70 cm (20–28 in) at birth; males reach maturity at 2.3–2.8 m (7.5–8.9 ft) long and 51 kg (113 lbs) and the females at 2.5–3.0 m (8.2–9.8 ft) and 41 kg (90 lbs). The young differ from the adults in having a rounded frontal margin on the head.[1][2] The typical lifespan of this species is 20–30 years;[2] the record Boca Grande female was estimated to be 40–50 years old.[6]

Human interactions[edit]

A great hammerhead caught by a sport fisherman. Human exploitation now threatens the survival of this species.

With its large size and cutting teeth, the great hammerhead is certainly capable of inflicting fatal injuries to a human and caution should be exercised around them. This species has a (possibly undeserved) reputation for aggression and being the most dangerous of the hammerhead sharks.[14][15] Divers underwater have reported that great hammerheads tend to be shy or unreactive toward humans.[8][11] However, there have been reports of great hammerheads approaching divers closely and even charging them when they first enter the water.[9][14] As of 2011, the International Shark Attack File lists 34 attacks, 17 of them unprovoked and none fatal, attributable to hammerhead sharks of the genus Sphyrna. Due to the difficulty in identifying the species involved, it is uncertain how many were caused by great hammerheads. This shark has been confirmed to be responsible for only one (provoked) attack.[16]

The great hammerhead is regularly caught both commercially and recreationally in the tropics, using longlines, fixed bottom nets, hook-and-line, and trawls. Though the meat is rarely consumed, their fins are becoming increasing valuable due to the Asian demand for shark fin soup.[1] In addition, their skin used for leather, their liver oil for vitamins, and their carcasses for fishmeal.[2] The great hammerhead is also taken unintentionally as bycatch and suffers very high mortality, over 90% for fisheries in the northwest Atlantic and the Gulf of Mexico. Entanglement in shark nets around Australian and South African beaches is another source of mortality.[1]

Conservation status[edit]

The great hammerhead is extremely vulnerable to overfishing due to its low overall abundance and long generation time. Assessment of its conservation status is difficult as few fisheries separate the great hammerhead from other hammerheads in their reported catches. This species is listed as globally Endangered on the IUCN Red List. It is Endangered in the northwestern Atlantic and the Gulf of Mexico, where though it is a non-targeted species, populations have dropped 50% since the 1990s due to bycatch. It is also Endangered in the southwestern Indian Ocean, where large numbers of longline vessels operate illegally along the coasts for hammerheads and the giant guitarfish (Rhynchobatus djiddensis). The great hammerhead catch rate in Indian Ocean has declined 73% from 1978 to 2003, though it is yet undetermined whether these represent localized or widespread depletion. The great hammerhead is Critically Endangered along the western coast of Africa, where stocks have collapsed with an estimated 80% decline in the past 25 years. The West African Sub-Regional Fishing Commission (SRFC) has recognized the great hammerhead as one of the four most threatened species in the region, though fishing continues unmonitored and unregulated. Off northern Australia, this species was assessed as Data Deficient but at "high risk". Concern has arisen there over a substantial increase in illegal, unreported, and unregulated (IUU) fishing, reflecting the raising value of this shark's fins.[1]

No conservation measures specifically protecting the great hammerhead have been enacted. It is listed on Annex I, Highly Migratory Species, of the UN Convention on the Law of the Sea, though no management schemes have yet been implemented under this agreement. The banning of shark finning by countries and supranational entities such as United States, Australia, and the European Union, and international regulatory bodies such as the International Commission for the Conservation of Atlantic Tunas (ICCAT), should reduce fishing pressure on the great hammerhead.[1]

References[edit]

  1. ^ a b c d e f g h Denham, J., Stevens, J., Simpfendorfer, C.A., Heupel, M.R., Cliff, G., Morgan, A., Graham, R., Ducrocq, M., Dulvy, N.D, Seisay, M., Asber, M., Valenti, S.V., Litvinov, F., Martins, P., Lemine Ould Sidi, M., Tous, P. and Bucal, D. (2007). "Sphyrna mokarran". IUCN Red List of Threatened Species. Version 2010.1. International Union for Conservation of Nature. Retrieved May 20, 2010. 
  2. ^ a b c d e f g h i j k l m Bester, Cathleen. Biological Profiles: Great Hammerhead. Florida Museum of Natural History Ichthyology Department. Retrieved on October 18, 2008.
  3. ^ a b c d e f Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 548–549. ISBN 92-5-101384-5. 
  4. ^ a b Lim, D.D.; Motta, P.; Mara, K.; Martin, A.P. (2010). "Phylogeny of hammerhead sharks (Family Sphyrnidae) inferred from mitochondrial and nuclear genes". Molecular Phylogenetics and Evolution 55 (2): 572–579. doi:10.1016/j.ympev.2010.01.037. PMID 20138218. 
  5. ^ Cavalcanti, M.J. (2007). "A Phylogenetic Supertree of the Hammerhead Sharks (Carcharhiniformes: Sphyrnidae)". Zoological Studies 46 (1): 6–11. 
  6. ^ a b c "Record Hammerhead Pregnant With 55 Pups". Discovery News. Associated Press. July 1, 2006. Retrieved October 18, 2008. 
  7. ^ Martin, R.A. (Mar 2007). "A review of shark agonistic displays: comparison of display features and implications for shark–human interactions". Marine and Freshwater Behaviour and Physiology 40 (1): 3–34. doi:10.1080/10236240601154872. 
  8. ^ a b Great Hammerhead. Elasmodiver.com. Retrieved on October 18, 2008.
  9. ^ a b Stafford-Deitsch, J. (1999). Red Sea Sharks. Trident Press Ltd. pp. 92–93. ISBN 1-900724-28-6. 
  10. ^ Whitty, J. (2007). The Fragile Edge: Diving and Other Adventures in the South Pacific. Houghton Mifflin Harcourt. p. 9. ISBN 0-618-19716-8. 
  11. ^ a b Hammerschlag, Rick. Sandy Plains: Great Hammerhead Shark. ReefQuest Centre for Shark Research. Retrieved on October 18, 2008.
  12. ^ Strong, W.R., Snelson, Jr., F.F., and Gruber, S.H. (Sep 19, 1990). "Hammerhead Shark Predation on Stingrays: An Observation of Prey Handling by Sphyrna mokarran". Copeia (American Society of Ichthyologists and Herpetologists) 1990 (3): 836–840. doi:10.2307/1446449. JSTOR 1446449. 
  13. ^ Chapman, D.D. and Gruber, S.H. (May 2002). "A further observation of the prey-handling behavior of the great hammerhead shark, Sphyrna mokarran: predation upon the spotted eagle ray, Aetobatus narinari". Bulletin of Marine Science 70 (3): 947–952. 
  14. ^ a b Stafford-Deitsch, J. (2000). Sharks of Florida, the Bahamas, the Caribbean and the Gulf of Mexico. Trident Press Ltd. pp. 90–91. ISBN 1-900724-45-6. 
  15. ^ Thornley, M., Dante, V., Wilson, P. and Bartholomew, W. (2003). Surfing Australia (second ed.). Tuttle Publishing. p. 264. ISBN 962-593-774-9. 
  16. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on April 24, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!