Overview

Comprehensive Description

Biology

Inhabits reefs, mangrove estuaries, and offshore trawling grounds (Ref. 3132). Found over muddy bottoms in shallow estuaries and along coasts. Marketed fresh (Ref. 12693).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: northwestern Australia, the Arafura Sea (Ref. 9819), Thailand, Indonesia and Papua New Guinea. Known from the Mekong delta (Ref. 12693).
  • Allen, G.R. and R. Swainston 1988 The marine fishes of north-western Australia: a field guide for anglers and divers. Western Australian Museum, Perth. 201 p. (Ref. 3132)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 21 - 23; Analsoft rays: 17 - 20; Vertebrae: 28 - 29
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

31.0 cm TL (male/unsexed; (Ref. 90102))
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by an elongate laterally compressed body; brown and dark edged pale blotches irregularly alternating on side and adjacent dorsal and anal fins; well contrasted bars and blotches on dorsal surface of head; caudal and pectoral fins with distinct brown bands; head depth 3.9-5.4 in SL; upper part of pectoral fin axil with small pore; gill opening extending across entire pectoral fin base; operculum with three spines; gill opening extending over five-sixths of base of pectoral fin; strong conical teeth in jaws, mainly in single series; orbital tentacles not equal in size, middle one usually smaller (Ref 90102).
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 0 - 36 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.5 - 68.6915
  Temperature range (°C): 24.491 - 24.872
  Nitrate (umol/L): 0.395 - 1.001
  Salinity (PPS): 35.339 - 35.443
  Oxygen (ml/l): 4.619 - 4.793
  Phosphate (umol/l): 0.112 - 0.144
  Silicate (umol/l): 0.406 - 1.141

Graphical representation

Depth range (m): 0.5 - 68.6915

Temperature range (°C): 24.491 - 24.872

Nitrate (umol/L): 0.395 - 1.001

Salinity (PPS): 35.339 - 35.443

Oxygen (ml/l): 4.619 - 4.793

Phosphate (umol/l): 0.112 - 0.144

Silicate (umol/l): 0.406 - 1.141
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Batrachomoeus trispinosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACACGTTGACTATACTCAACAAACCACAAAGACATTGGAACCTTATACCTTGTATTCGGTACATGAGCCGCAATAGTTGGTGCCGCACTCAGCCTCTTACTACGCACAGAACTTTCACAACCTGGCCCCTTTCTTGGAAAT---GACCAAATCTATAACGTTATTGTTACAGCCCACGCCTTCGTAATAATCTTCTTCATGGTCATACCCATTATAATTGGTGGCTTCGGAAACTGACTCATTCCCCTAATAATTGGTGCTCCGGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTCCCACCATCATTCTTCCTTCTCCTAGCTTCATCAACAGTAGAAGCAGAAGCAGGAACTGGGTGAACTATTTATCCCCCACTAGCTAATAACATTGCACATGCAGGTGCCTCCGTAGACCTGACAATCTTTTCACTTCACCTAGCTGGTGTCTCATCAATCCTCGGCGCTATTAACTTCATCACAACAATTATTAACATAAAACCAAAAGCCTCCACACAATACCAAACCCCTCTTTTTATCTGAGCACTAATAATCACAGCAGTCCTTCTGCTTCTATCTTTACCAGTCCTTGCCGCTGGAATCACAATACTTCTAACAGACCGTAACCTAAATACAACATTCTTTGACCCTGGAGGAGGAGGAGACCCCATCCTATTTCAACACCTCTTTTGATTCTTTGGCCACCCTGAAGTTTATATTTTAATTCTCCCAGGATTCGGTATGATCTCACACATTGTCGCCTTTTATTCAGGAAAAAAAGAACCCTTTGGCTACATAGGCATGGTCTGAGCTATAATAACCATCGGTCTCCTAGGCTTCATTGTTTGAGCCCACCACATATTTACAGTCGGAATAGATGTTGATACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Batrachomoeus trispinosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!