Overview

Brief Summary

Conus generalis, common name the general cone, is a species of sea snail. These snails are predatory and venomous. The color of the shell is orange-brown to chocolate, irregularly white-banded at the shoulder, in the middle, and at the base. These two or three bands are overlaid with zigzag or irregular chocolate-colored markings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in from the south east coast of India, east to French Polynesia, north to Ryukyu Islands in Japan, and then south to the coast of Queensland, Australia. Hawaii is excluded from this range. It is also present around the Maldives (Rckel et al. 1995). Both the EOO and the AOO exceed the thresholdsfor criteria B1 and B2. This species can be found from 2 to 240 m (A.J. Kohn and G.T. Poppe pers. comm. 2011) and is most common at 25 m in the Philippines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

A thick, broad shell, up to 9 cm, with characteristic small, pointed spire and large body whorl. Colour cream or pink with with 2-3 brown or black, wide spiral bands. Aperture white. Habitat: various shallow substrates. Distribution: Indo-Pacific. (Richmond, 1997)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found on sand, muddy sand, coral rubble in subtidal habitats where it is most common, but it has also been found to 240 m. Once mature, it can reach a size ranging from 50 to 104 mm (Rckel et al. 1995). It feeds on polychaetes (Kohn 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 52 specimens in 2 taxa.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 1 - 110
  Temperature range (°C): 23.011 - 25.491
  Nitrate (umol/L): 0.232 - 2.089
  Salinity (PPS): 34.735 - 35.412
  Oxygen (ml/l): 4.488 - 4.754
  Phosphate (umol/l): 0.083 - 0.172
  Silicate (umol/l): 0.777 - 3.928

Graphical representation

Depth range (m): 1 - 110

Temperature range (°C): 23.011 - 25.491

Nitrate (umol/L): 0.232 - 2.089

Salinity (PPS): 34.735 - 35.412

Oxygen (ml/l): 4.488 - 4.754

Phosphate (umol/l): 0.083 - 0.172

Silicate (umol/l): 0.777 - 3.928
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 52 specimens in 2 taxa.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 1 - 110
  Temperature range (°C): 23.011 - 25.491
  Nitrate (umol/L): 0.232 - 2.089
  Salinity (PPS): 34.735 - 35.412
  Oxygen (ml/l): 4.488 - 4.754
  Phosphate (umol/l): 0.083 - 0.172
  Silicate (umol/l): 0.777 - 3.928

Graphical representation

Depth range (m): 1 - 110

Temperature range (°C): 23.011 - 25.491

Nitrate (umol/L): 0.232 - 2.089

Salinity (PPS): 34.735 - 35.412

Oxygen (ml/l): 4.488 - 4.754

Phosphate (umol/l): 0.083 - 0.172

Silicate (umol/l): 0.777 - 3.928
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Conus generalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GACCTTATATATTTTATTTGGAATATGATCTGGATTAGTTGGGACTGCATTAAGACTATTAATTCGTGCAGAACTAGGGCAACCTGGTGCGCTACTTGGAGATGATCAGTTATATAATGTAATCGTGACAGCGCATGCTTTTGTTATAATTTTTTTTTTAGTAATACCTATGATGATTGGGGGATTTGGAAACTGATTGGTACCACTGATATTAGGAGCTCCAGATATAGTTTTTCCTCGATTAAATAATATAAGTTTTTGACTTTTACCTCCAGCTTTATTGCTTCTTTTATCATCAGCTGCAGTAGAAAGCGGGGTAGGGACTGGATGGACGGTATATCCACCTTTGGCGGGAAATCTTGCTCATGCTGGTGGTTCTGTTGATTTAGCAATTTTTTCTTTACATCTTGCTGGAGTGTCTTCTATTTTAGGGGCTGTAAATTTTATTACTACAATTATTAATATACGATGACAAGGAATGAAATTTGAACGACTTTCTCTATTTGTTTGATCAGTAAAGATTACGGCTATTTTACTTCTTTTATCTCTACCTGTATTAGCTGGAGCTATTACTATGCTTCTAACTGATCGAAATTTTAATACTGCTTTCTTTGATCCAGCAGGAGGTGGTGATCCTATTTTGTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Conus generalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Kohn, A.

Reviewer/s
Peters, H. & Poppe, G.

Contributor/s

Justification
This species is found in from the south east coast of India, east to French Polynesia, north to Ryukyu Islands in Japan, and then south to the coast of Queensland, Australia. Hawaii is excluded from this range. It is also present around the Maldives. This species is widespread, common and locally abundant. There are no major threats, therefore it is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common and locally abundant (G.T. Poppe pers. comm. 2011).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures currently in place for this species. It is found in marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Conus generalis

Conus generalis Linnaeus, C., 1767

Conus generalis, common name the general cone, is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[2]

These snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

The size of an adult shell varies between 45 mm and 105 mm. The spire is rather plane, with a characteristic, small, acuminate, raised apex. The color of the shell is orange-brown to chocolate, irregularly white-banded at the shoulder, in the middle, and at the base. These two or three bands are overlaid with zigzag or irregular chocolate-colored markings. The aperture is white.[3]

Distribution

This species occurs in the Red Sea, in the Indian Ocean along Madagascar, Mauritius and Tanzania; in the Indo-West Pacific along Indonesia and the Philippines and from Northwest Australia to French Polynesia and the Ryukyu Islands; in the Central Indian Ocean along the Maldives.

References

  1. ^ Linnaeus, C., 1767. Systema Naturae per Regna Tria Naturae, 12th ed., 1, pt. 2
  2. ^ a b Conus generalis Linnaeus, 1767.  Retrieved through: World Register of Marine Species on 24 July 2011.
  3. ^ George Washington Tryon, Manual of Conchology vol. VI, p. 34
  • Dautzenberg, Ph. (1929). Mollusques testacés marins de Madagascar. Faune des Colonies Francaises, Tome III
  • Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp.
  • Tucker J.K. (2009). Recent cone species database. September 4, 2009 Edition
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!