Overview

Brief Summary

The galah (Eolophus roseicapilla) is a small pink and grey cockatoo, 24-40 centimetres in length and 227-380 grams in weight. The sexes look alike, but the eyes of the male are dark brown, while those of the female are pinkish-red. It is the most widespread and abundant of the Australian cockatoos and is found throughout the interior areas of the Australian mainland. The original habitat of the galah was chiefly inland semi-arid shrublands and drier coastal areas to the north. The birds were typically found along watercourses with suitable nesting and roosting trees.

Galahs are sociable birds, often seen in flocks of more than 100 individuals. Flocks of up to 2,000 have also been recorded. They forage mostly on the ground for seeds. Hollows in living or dead eucalypts trees near a water source are used for nesting. When hollows are scarce, galahs will also use cliffs or steel pipes used for gate posts.

Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 40 years (captivity) Observations: One specimen lived 40 years in captivity (Flower 1938).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eolophus roseicapilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCGGACCGCCCTAAGCTTGCTCATCCGCGCAGAACTCGGYCAGCCAGGAACCTTACTAGGAGACGACCAAATTTACAATGTAATCGTTACTGCCCATGCTTTCGTAATAATCTTTTTCATAGTAATACCAATCATAATCGGAGGATTTGGGAACTGACTGGTGCCCCTTATAATTGGTGCTCCCGATATAGCATTCCCACGCATAAACAACATAAGCTTCTGGCTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCATCCACAGTTGAGGCCGGAGCAGGTACAGGGTGAACTGTCTACCCACCCCTAGCCGGAAACCTAGCCCATGCTGGAGCATCAGTAGACCTAGCTATTTTTTCCCTCCATTTAGCAGGTGTATCTTCCATCCTAGGAGCTATCAACTTCATCACCACTGCCATTAACATAAAACCACCCGCCCTATCACAATATCAAACCCCACTATTTGTTTGATCTGTCCTCATTACCGCCGTGCTACTTCTACTATCCCTCCCAGTCCTAGCTGCTGGCATTACCATACTCCTCACAGACCGTAACCTAAACACCACATTCTTTGACCCCGSAGGAGGAGGAGACCCAGTCCTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTATACATCCTCATCCTCCCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eolophus roseicapilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5