Overview

Brief Summary

Description

The pygmy hippopotamus shares the barrel-shaped body form of the closely related common hippopotamus (Hippopotamus amphibius), but is considerably smaller. Other physical differences between the two hippopotamus species include the placing of the eyes, which are more towards the side of the head in the pygmy hippopotamus, feet that are not as webbed as in the common hippopotamus (2), and the pygmy's sloping smooth, greenish-black back (7). The sexes are similar in appearance; as males do not have a scrotum, males and females are very difficult to tell apart (7). The name hippopotamus derives from the Greek for 'river horse' (2). Genetic studies have revealed that hippopotami share a common ancestor with whales (2), while recent fossil evidence alludes to a close relationship between whales and all ungulates (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

The pygmy hippopotamus spends the day in water, and emerges at night to feed on fruits, leaves, roots and grasses (2), which it bites with the thick lips rather than with the teeth (2). Hippopotami have extraordinarily high rates of water loss (three to five times the rate in man) due to their unique skin structure; this explains why they must spend the day in water (2). Pygmy hippopotami usually live alone unless they are mating or with a calf, and they are not thought to hold territories (2). The home ranges of various individuals often overlap, but individuals seem to actively avoid encounters with others, possibly through dung marking (5). In the breeding season, males seek out females and form consortships for a time prior to mating, which tends to occur in the water but may also occur on land (2). Gestation lasts about 6.5 months, calves are suckled for six to eight months and stay with their mother until around eight years of age, when they are fully grown (2). The pygmy hippopotamus is not a particularly vocal species, but has been recorded grunting, hissing, squeaking and snorting (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Pygmy Hippopotamus according to MammalMAP

The Pygmy Hippopotamus (Choeropsis liberiensis) inhabits the cool forests and swamps of Western Africa, principally Liberia, and is an elusive creature owing to its small stature and nocturnal habits. This EDGE (Evolutionary Distinct and Globally Endangered) species stands a mere 75-100 cm tall at the shoulder and is about one fifth the weight of its larger cousin, the common hippopotamus. There are other notable differences between these two species such as the more solitary nature of the pygmy hippo compared to the common hippo as well as spending less time in water bodies (despite having webbed toes), preferring to cool off in the surrounding mud and burrows of other animals. Local legends tell of the Pygmy hippo sweating blood, but scientists believe that the red substance they secrete acts as an antibiotic and sunscreen.

This herbivorous animal can reach top speeds of 30 km/h and has a relatively long life-span of up to 40 years in the wild. However, their numbers in the wild are dwindling, predominantly as a result of habitat loss and illegal poaching, but also due to the fact that they only reach sexual maturity at 4-5 years of age and giving birth to a single calf after 7 months of gestation. 

The Pygmy hippo was listed as Endangered on the IUCN Red List of Threatened Species. A formal recent assessment of the population revealed that an estimated 2000-3000 individuals remain in the wild. In 2012, a National Action Plan for the Conservation of the Pygmy Hippopotamus in Liberia was produce with the primary goal “To assess the current status of the Pygmy hippo across its range and ensure effective  protection of, and connectivity between, known populations.

For more information on MammalMAP, visit the MammalMAP virtual museum or blog.

Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Pygmy Hippopotamuses range in weight from 160 to 275 kg (352-605 lbs.). Their skin color is dark brown on top, fading to a lighter color underneath. Large glands in the skin produce a glossy, brownish-red secretion that is referred to as “blood sweat,” which protects their sensitive skin from sun.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The nominate subspecies is endemic to the Upper Guinea Forest of West Africa, occurring in four countries, Cte d'Ivoire, Guinea, Liberia and Sierra Leone. The second subspecies, C. l. heslopi, formerly occurred some 1,800 km to the east, on the other side of the Dahomey Gap, in Nigeria from the Niger Delta east to the Cross River in Nigeria (Heslop 1945; and see Corbet 1969, Ansell 1972). There have been no reliable reports of this subspecies since 1945, and its continued presence seems unlikely (Robinson 2013).

The historic distribution of the Pygmy Hippo was far more extensive than the distribution today. Populations have disappeared from many sites and become fragmented across the landscape. There are confirmed recent records from localities in each of the four range countries and additional sites that have not been surveyed in recent years may still harbour Pygmy Hippo populations (Mallon et al. 2011). Full details of the current distribution are therefore unknown but a best assessment is provided by Mallon et al. (2011).

Liberia is at the centre of the species range and has the most extensive tracts of intact lowland forest in the region (Christie et al. 2007), with occurrence in the other three range countries primarily close to their borders with Liberia: eastern Sierra Leone, south-east Guinea, and south-west Cte dIvoire (Eltringham 1993, 1999; Grubb et al. 1998; Roth et al. 2004; Mallon et al. 2011).

In Sierra Leone, Pygmy Hippo populations are found in the Gola Forest region bordering Liberia, around the Loma Mountains in the north of the country and along the Moa River, including Tiwai Island (Mallon et al. 2011). There are still rumours of Pygmy Hippos in the Outamba-Kilimi National Park in north-west Sierra Leone where it is possible they may survive in sympatry with the Common Hippo but there is no reliable evidence to confirm this.

The Republic of Guinea has a fragmented Pygmy Hippo population occurring in the forest zone of the south-east. There are records since 2000 from the Ziama Biosphere Reserve, Dick Forest Reserve, Mont Bro Reserve, and also in Tinzou Community Reserve. Pygmy Hippos formerly occurred in Dr Forest in the extreme south on the border with Liberia but a survey carried out by the NGO Sylvatrop in 2009 found no evidence of Pygmy Hippo presence (Mallon et al. 2011). No evidence of Pygmy Hippos has been found in the Guinea part of the Cavally River (Robinson 2013).

In Cte dIvoire the most important site for Pygmy Hippos is Ta National Park and its adjacent zone of protection including NZo Faunal Reserve (Roth et al. 2004). They are also reported to be present in the Goin Db Classified Forest, Cavally Classified Forest on the border with Liberia and Azagny National Park in the south-centre of the country (Mallon et al. 2011).

In Liberia the Pygmy Hippo population is divided between the two large remaining blocks of forest in the southeast and northwest of the country. The population in the southeast is centred on Sapo National Park (Collen et al. 2011) with recent records along the Duobe River to the north of Sapo across to the Grebo National Forest on the border with Cte d'Ivoire, as well as along Kia Creek in Maryland/River Gee counties and within the proposed Grand Kru-River Gee Protected Area (Mallon et al. 2011). Pygmy Hippos are still likely to occur in other forests between the Cestos and Senkwehn rivers, where abundant signs of their presence were found in 1998 (Robinson and Suter 1999). In the northwest, there are recent records along the border with Sierra Leone in the Gola National Forest and in the Wonegizi National Forest on the border with Guinea (Mallon et al. 2011).

Records of the species from Gambia and Ghana were rejected by Grubb et al. (1998), while another isolated record from Guinea-Bissau (Cristino and Melo 1958) almost certainly refers to the Common Hippo (Robinson 2013).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The range of current populations of Hexaprotodon liberiensis is limited to just four West African countries: Liberia, Ivory Coast, Sierra Leone, and Guinea. The majority of the estimated total population of 2,000 to 3,000 is concentrated in Liberia. Smaller populations occur in the other three countries in national forests and reserves. Other than its more recent habitat loss due to human development, the range of H. liberiensis is speculated to have never been much larger than it is today.

The range of H. liberiensis and that of its closest living relative, Hippopotamus amphibius, do not overlap.

The skull of a subspecies, H. l. heslopi, was described in the 1940's from the Niger Delta, Nigeria. Whether this subspecies is still in existence there is unknown, although it is highly unlikely since there is no other documented evidence of its presence.

Biogeographic Regions: ethiopian (Native )

  • Eltringham, S. 1999. The Hippos. San Diego, California: Academic Press.
  • Lang, E. 1990. Pygmy Hippoptamuses. Pp. 58-64 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals, Vol. 5, 1 Edition. New York: McGraw-Hill Publishing Company.
  • Lewison, R., W. Oliver. 2008. "2008 IUCN Red List of Threatened Species" (On-line). IUCN 2008 Red List. Accessed September 03, 2008 at http://www.iucnredlist.org/details/10032.
  • Oliver, W. 1993. Status Survey and Conservation Action Plan: Pigs, Peccaries, and Hippos. Gland, Switzerland: IUCN.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The pygmy hippopotamus is found in western Africa, mainly in Liberia but also in Sierra Leone, Guinea, and the Ivory Coast (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Pygmy hippopotamuses range in mass from 160 to 275 kg. Body lengths are 1.5to 1.75 m and tail lengths are 0.2 m. Height is 0.7 to 1.0 m at the shoulder. Despite the name "Hexaprotodon," these hippopotamuses have only two pairs of upper and one pair of lower incisors. The dental formula is 2/1, 1/1, 3/3, 3/3; 34 teeth in all. The canines are ever-growing. The skin color is dark brown on top, fading to a lighter, fleshy color on the belly and throat. Large glands in the dermis produce a glossy, brownish-red secretion that is referred to as “blood sweat”. These secretions protect the sensitive skin from sun. It may be an adaptive replacement of sweat since the production of the blood sweat has been observed to increase when intense physical exertion such as running or mating takes place.

Hexaprotodon liberiensis is most commonly compared to its larger relative Hippopotamus amphibius. While pygmy hippopotamuses are obviously smaller in body size, they also have some rather distinct physical adaptations that distinguish them from H. amphibius individuals. Proportionally, the legs and neck of H. liberiensis are longer, and the head is smaller relative to body size. The digits of pygmy hippos are more spread out and have less webbing between digits than common hippos.  In general, pygmy hippos have many adaptations that are thought to be advantageous to terrestrial mobility. Their orbits are positioned on the sides of the head rather than on top. Their backs are forward sloping, a trait thought to enhance movement through thick vegetation. A feature that they share with their larger relative is the muscular valves of the ears and nose, which are capable of closing under water.

Range mass: 160 to 275 kg.

Range length: 1.50 to 1.75 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Prothero, D., S. Foss. 2007. The Evolution of Artiodactyls. Baltimore, Maryland: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Pygmy Hippo is rarely seen because of its secretive, nocturnal habits and consequently not much is known of its ecology. The most detailed field studies are those by Robinson (1970), Blow (1988) and Hentschel (1990). A general account of its biology is given by Eltringham (1999) and Robinson (1981b) compiled a detailed bibliography of the species.

The Pygmy Hippo is solitary except when a female is accompanied by young or during the brief association of a breeding pair (Robinson 1970, 1996; Robinson and Suter 1999). They are primarily, but not exclusively, nocturnal. Radio-collaring evidence showed that in Azagny National Park they were active mainly from late afternoon until midnight with peak activity between 16:00h and 23:00h (Blow 1988). Recent camera trapping in Liberia and Sierra Leone has revealed that they may also be active throughout the night and also during the day. They spend the day hidden in swamps, wallows or hollows under the banks of streams (Robinson 1981a, Roth et al. 2004) or on drier ground within swamps (Blow 1988). Pygmy Hippos follow well-defined trails or tunnel-like paths through the forest and swamp vegetation, which they mark by spreading dung by vigorously wagging their tail while defecating (Johnston 1906, Robinson 1970, White 1986).

It mainly inhabits lowland primary and secondary forests, close to rivers, streams and Raphia palm tree swamps (Robinson 1970, Blow 1988, Eltringham 1999), sometimes being found along gallery forests extending into Transitional Woodland and the southern Guinea savanna. The habitat characteristics which appear to be most important are the presence of small streams with submerged trees, root hollows, swampy depressions, and the size and density of ground vegetation (Roth et al. 2004).

Pygmy Hippos feed on terrestrial and semi-aquatic plants. In the wild, they are known to eat ferns, tender roots, grasses, herbs, stems and leaves of young trees, vegetables and fallen fruit; they have also been observed to eat sweet potato leaves, okra, pepper plants, cassava and the tender shoots of young rice plants on plantations and farms at the forest edge (Robinson 1970, 1996; Blow 1988; Hentschel 1990), but are not regarded as crop pests. Robinson (2013) consistently found that a small, recumbent, vine-like forb, widely known as Deewinkon (Geophila sp.) is a preferred food throughout Liberia.

Pygmy Hippos have been reported to feed for 5.8-6 hours per day, between mid-afternoon and midnight (Robinson 1981a, Eltringham 1999) but camera trapping has shown they may feed throughout the night. They may defoliate young trees by taking the base of the twig in its mouth, then shaking its head while pulling the twig through the mouth and they have also been observed standing on their hind legs with their front legs against the stem to reach ferns growing within Raphia palms (Blow 1988). White (1986) recorded Pygmy Hippos taking fish from traps in Sierra Leone.

The stomach has four chambers (Langer 1988). The first three are covered with tough keratinized epithelium, only the last containing glandular epithelial tissue. There is evidence that microbial breakdown of plant material takes place in the first three stomach chambers, no caecum being present in this species. This mode of digestion is usually considered an adaptation to a highly fibrous, generally "low-quality" vegetable diet. The droppings are poorly formed and similar to those of the Common Hippo. Heaped dung and tail-splattered excrement are commonly found along trail-side vegetation.

Little is known about Pygmy Hippo ranging patterns, home range size or territoriality. Blow (1988) radio collared five animals (four females, one male) in Azagny National Park, Cte dIvoire, and tracked them for 3-6 months (Blow 1988). This study found that female home ranges overlapped and estimated that they covered 40-60 ha, while the home range of the male covered 150 ha. Blow (1988) also found that the male Pygmy Hippo covered a distance of two km per day, whereas the longest recorded distance moved by a female was 900 m. Home ranges seem to depend on the presence of small streams with submerged trees, root hollows, swampy depressions, and size and density of ground vegetation, rather than nutritional factors or proximity of rivers (Roth et al. 2004). During the rainy season (MaySeptember), animals are reported by hunters to disperse over wide areas in the forest zone.

No accurate data on reproduction, including breeding season, have been published for the wild populations. Sexual maturity occurs at about four to five years of age. From studies of captive animals (Lang 1975, Tobler 1991), the oestrous cycle has been shown to average 35.5 days with oestrus itself being 2448 hours long. The average gestation length is 188 days. A single young is born with a birth-weight of 4.56.2 kg. Twins are born very rarely the incidence being approximately one in every 200 births (Hlavacek et al. 2005) The young are born on land and there is no evidence from captive births that a nest is constructed. A survey of over 800 births indicates that these occur throughout the year (Tobler 1991) although Robinson (1970) reports hunters observing newborns more commonly in the early dry season between November and January. Weaning occurs at 68 months. Reproductive maturity is reported to be 35 years (Lang 1975). Captive adult body size is achieved by three years. Maximum age in captivity is approximately 3540 years but no while no data exist for wild animals.

In captivity, copulation has been observed on land and in water but, unlike the Common Hippo, birth takes place on land. Young calves do not follow their mothers around but are left parked by the mother in secluded pools with the mother returning at intervals to suckle (Galat-Luong 1981). This explains why tracks of young animals are hardly ever found (Hentschel 1990), because young start following their mothers at around 35 months of age when they are already quite large.

In general, the range of the Pygmy Hippo does not overlap with that of the Common Hippo but they may once have been sympatric in a few places in Liberia (Schomburgk 1913) and northwest Sierra Leone (Teleki and Baldwin 1980, Grubb et al. 1998). Roth et al. (2004) reported that in Cte d'Ivoire along the Bandama River, almost as far north as the confluence of the Nzi, where they were still found together with the Common Hippo in 1986.

The effects of natural predators on the pygmy hippo are unknown, but the principal carnivores capable of attacking an adult animal of this size are the Leopard Panthera pardus (Robinson 1970) and Nile Crocodile Crocodylus niloticus. Hentschel (1990) obtained a photograph of a juvenile Pygmy Hippo killed by a Leopard and Roth et al. (2004) saw two animals that had been mauled. Young animals are vulnerable to a wider range of predators, including African Golden Cat Caracal aurata, African Civet Civettictis civetta (Eltringham 1999) and African Rock Python Python sebae.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hexaprotodon liberiensis is only found in low-lying, forested areas, never far from a source of water. Pygmy hippopotamuses use swamps, streams, and rivers as refuges from danger and to keep their sensitive skin moist. Open areas are completely avoided and most travel is limited to worn-down, tunnel-like paths through dense vegetation on land. Narrow waterways are also used to navigate through swampy areas. Pygmy hippopotamuses have been found in burrows deep in the sides of river banks. It is unlikely that they dig burrows themselves, but they may enlarge existing ones. Because entrances of these burrow open toward the river and are mostly submerged below the water level, they are ideal for the semi-aquatic lifestyle of H. liberiensis.

Habitat Regions: tropical ; terrestrial ; freshwater

Terrestrial Biomes: forest ; rainforest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: swamp

Other Habitat Features: caves

  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. San Diego, California: Academic Press.
  • Leidy, 1991. Pygmy Hippopotamus. Pp. 1350-1351 in R Nowak, ed. Walker's Mammals of the World, Vol. 2, 5 Edition. Baltimore Maryland: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current populations of the Pygmy Hippoptamus are limited to just four West African countries: Liberia, Ivory Coast, Sierra Leone and Guinea. The majority of the total estimated population of 2,000 to 3,000 is concentrated in Liberia in patches of lowland forest near sources of water.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits rivers and swamps in a handful of dense lowland forest patches (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Pygmy hippos are strictly vegetarian, or herbivorous. They eat a wide variety of plant foods including herbs, broad-leaved plants, grasses, semi-aquatic plants, herbaceous shoots, forbs, sedges, ferns, and fallen fruit. Considered a pseudo-ruminant, pygmy hippos have a four-chambered stomach but do not ferment food or use microbes in the same way as true ruminants. They also do not chew their cud.

Plant Foods: leaves; roots and tubers; fruit

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Specific ecosystem roles of pygmy hippos are unknown but their herbivorous diet probably has an effect on plant populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The main predators of pygmy hippos are leopards (Panthera pardus). Other potential predators include large African rock pythons and crocodiles. When startled, pygmy hippos flee a short distance into vegetation, where they hide.

Known Predators:

  • leopards (Panthera pardus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Pygmy hippos use scent marking with their feces to alert other hippos to their presence. Like other mammals, they may use scent cues to advertise reproductive status as well. Pygmy hippos are typically silent, but do make snorts, grunts, hisses, and squeaks occasionally. Otherwise, little is known about how pygmy hippos communicate.

Communication Channels: chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Boitani, L., S. Bartoli. 1982. Simon & Schuster's Guide to Mammals. New York: Fireside/Simon & Schuster, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pygmy Hippopotamuses are strictly herbivorous. They feed on a wide variety of plant foods including herbs, broad-leaved plants, grasses, semi-aquatic plants, herbaceous shoots, forbs, sedges, ferns, and fallen fruit.

The Pygmy Hippopotamus is generally solitary, scent marking with feces to alert intruders to its presence. Mothers leave their newborn calves alone while searching for food, returning about three times a day for suckling. Calves are ready to forage with their mother at about three months of age.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The lifespan of Hexaprotodon liberiensis individuals in the wild is unknown. In captivity individuals have lived up to 43 years.

Range lifespan

Status: captivity:
43 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 42.3 years (captivity) Observations: One captive specimen lived 42.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating system of H. liberiensis has only been observed in captive individuals. In captivity only monogamous mating has occurred. This is very unlikely in the wild, however, because the home range of a single male overlaps the home ranges of several females. Mating in captivity has been observed both on land and in water and can take place one to four times during the female's estrous period, which lasts one or two days.

Mating System: monogamous ; polygynous

Very little is known about the reproductive behavior of H. liberiensis in the wild. All of the information here is based on observations of captive animals. The breeding season is unknown in the wild but in captivity can occur at any time of the year. The breeding interval is between 7 and 9 months. The gestation period lasts as little as 184 days or as long as 210 days. One offspring is normally produced; the occurrence of twins is very rare. Offspring weigh 3.4 to 6.4 kg and are generally well developed. Newborn males weigh slightly more than females. Weaning occurs between 6 and 8 months and an individual reaches sexual maturity in 3 to 5 years.  Births have occurred both on land and in water in captivity. Births taking place in deep water almost always result in the newborn drowning.

Breeding interval: Breeding can occur as often as every 7 to 9 months.

Breeding season: Breeding occurs year round in captivity. Seasonality in the wild is unknown.

Average number of offspring: 1.

Range gestation period: 184 to 210 days.

Range weaning age: 6 to 8 months.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Hexaprotodon liberiensis is considered a K-selected species, which means it produces few offspring and invests a lot of energy into offspring development. Newborn calves are left in one place while the mother searches for food, returning about three times a day for suckling. They young are usually able to feed on vegetation after three months. These behaviors have been observed both in captivity and in the wild.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Eltringham, S. 1999. The Hippos. San Diego, California: Academic Press.
  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. San Diego, California: Academic Press.
  • Lang, E. 1990. Pygmy Hippoptamuses. Pp. 58-64 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals, Vol. 5, 1 Edition. New York: McGraw-Hill Publishing Company.
  • Leidy, 1991. Pygmy Hippopotamus. Pp. 1350-1351 in R Nowak, ed. Walker's Mammals of the World, Vol. 2, 5 Edition. Baltimore Maryland: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hexaprotodon liberiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAACCGCTGACTATTCTCAACTAACCACAAAGACATCGGTACATTATATCTACTATTCGGTGCCTGAGCTGGCATAGCAGGCACTGCCCTAAGCCTACTAATCCGTGCCGAACTAGGCCAACCTGGTACACTACTAGGAGATGACCAAATTTATAACGTAGTCGTCACAGCTCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATAATCGGCGGGTTCGGAAACTGACTTGTTCCACTAATAATCGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAACATAAGCTTCTGACTACTTCCCCCCTCTTTCCTACTATTATTAGCATCCTCCATAGTAGAAGCAGGAGCAGGAACAGGCTGGACCGTCTATCCCCCTTTAGCTGGAAATTTAGCCCATGCTGGAGCCTCCGTAGACCTTACAATTTTCTCCCTCCACCTGGCCGGAGTTTCCTCTATTCTAGGTGCAATCAATTTCATTACAACCATCATTAACATAAAACCACCCGCCATATCCCAATATCAAACCCCACTGTTCGTCTGATCAGTTCTAATCACAGCCGTACTACTTCTACTCTCCCTACCCGTTCTAGCAGCAGGTATTACTATGCTACTTACAGACCGAAACCTAAATACCACCTTCTTTGACCCTGCGGGAGGAGGTGACCCTGTCCTTTATCAACACTTATTCTGATTCTTCGGACACCCCGAAGTATACATCCTCATCCTCCCCGGCTTCGGAATGATCTCACACATTGTAACCTATTACTCCGGAAAAAAAGAACCCTTTGGATACATAGGCATGGTTTGAGCCATGATATCCATCGGATTCCTAGGATTTATTGTATGGGCCCATCACATATTTACAGTAGGTATAGATGTGGACACCCGAGCATACTTTACATCCGCCACTATAATTATTGCCATCCCCACAGGAGTAAAAGTATTTAGCTGATTAGCAACACTACATGGAGGGAACATCAAGTGATCCCCTGCTATGATATGAGCCCTAGGCTTTATTTTCCTATTCACAGTGGGTGGCCTAACAGGTATTGTTTTAGCCAACTCATCCCTAGACATCGTCCTCCATGACACCTATTACGTAGTAGCCCACTTCCATTATGTACTCTCAATAGGCGCCGTCTTCGCTATCATAGGAGGCTTCGTACACTGATTCCCACTATTTTCGGGGTATACACTCAATGACACATGAGCAAAAATCCACTTCGTAATTATATTCGTGGGGGTCAATCTAACTTTCTTCCCACAACATTTCTTAGGTCTATCCGGAATACCTCGACGATACTCCGACTACCCAGACGCCTATACAACATGAAATACTATCTCCTCAATAGGCTCATTTATCTCACTGACAGCTGTAGTACTAATAGTATTTATCATTTGAGAGGCATTTGTCTCCAAACGAGAAGTCTTAGCTGTAGATCTAACTACGACGAACCTAGAGTGACTAAACGGATGCCCTCCACCATACCACACATTTGAAGAACCCGCATAYGTGAGCTTAACTAACCAAAACAAGAGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hexaprotodon liberiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C1

Version
3.1

Year Assessed
2015

Assessor/s
Ransom, C, Robinson, P.T. & Collen, B.

Reviewer/s
Mallon, D. & Lewison, R.

Contributor/s
Oliver, W.R.T.

Justification

Published figures on population size are contradictory, with some reports from Cte d'Ivoire indicating that numbers are probably higher than pre-existing estimates (Robinson 2013). However, evidence from camera trapping and sign surveys indicates that densities are low, particularly in key sites, such as Sapo National Park, Liberia. Large areas of the original forest habitat, especially in Cte d'Ivoire, have been destroyed or degraded by commercial plantations of oil palm and other products, shifting cultivation, mining and logging, and hunting for bushmeat is increasing throughout the range (Mallon et al. 2011, FFI and FDA 2013). Even if the estimate of 2,000-3,000 used previously was doubled to 4,000-6,000, using the lower end of the range (4,000), on a precautionary basis, suggests that the number of mature individuals is still <2,500. A continuing decline of around 20% over two generations (26 years; Pacifici et al. 2013) is estimated based on the extent of forest loss across the range in combination with an increase in hunting intensity, hence the species qualifies for listing as Endangered under criterion C1.


History
  • 2008
    Endangered (EN)
  • 2006
    Endangered (EN)
  • 1996
    Vulnerable (VU)
  • 1994
    Vulnerable (V)
  • 1990
    Vulnerable (V)
  • 1988
    Vulnerable (V)
  • 1986
    Vulnerable (V)
  • 1965
    Status inadequately known-survey required or data sought
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pygmy hippos are classified as Endangered by the IUCN and are on Appendix II of CITES. Threats to H. liberiensis populations include deforestation, hunting, agricultural land development, and civil conflicts. Pygmy hippos are legally protected in most of the regions where they are found. However, there are little or no resources available to enforce their protection and numbers in the wild continue to decrease. The subspecies H. l. heslopi is considered extinct in the wild, although its existence is still questioned because reports of individuals in Nigeria are questionable.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Status: ENDANGERED

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) by the IUCN Red List (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The total size of the wild population is unknown. The 1993 IUCN Status Survey and Action Plan estimated the population at "a few thousand at most" (Eltringham 1993). This estimate was cited as "2,000-3,000" in the 2008 IUCN Red List assessment (Lewison and Oliver 2008) who suggested that even that figure may be too high.

However, some much higher population estimates, originally published in GTZ reports (Hoppe-Dominik 1999) and in university theses (Blow 1988, Hentschel 1990), have been made for Cte dIvoire. These have been assessed and summarised by Roth et al. (2004).

Density estimates were calculated from track and dung counts made along fixed transects during a long-term monitoring programme in Ta National Park. Hentschel (1990) estimated mean densities of 3.6 individuals/km2 in primary forest, with a maximum of 7.6/km2 in one locality, and 2.9/km2 in secondary forest. On the basis of these figures, Roth et al. (2004) concluded that there may have been 10,000 Pygmy Hippos in Ta National Park and 19,000 in Cte dIvoire during 1982-1986, but that numbers in Ta had fallen to 5,000 by 1997. Densities in the east of Ta fell to 0.3/km2 in 1998 and 0.2/km2 in 2001 and in the west to 0.8/km2 in 1995 and 1.4/km2 in 1998; while the latest figures showed densities in the best areas of 1.4-2.5/km2 (Hoppe-Dominik 1999, Roth et al. 2004).

The present size of the global population is unknown, but it is widely considered to be declining based on the evidence of rate of conversion of forest habitat in the range, reports of poaching and the reduced densities in Ta National Park reported by Roth et al. (2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The range of this species has changed markedly in the past 100 years (Robinson 1970, 1971, 2013), but most acutely in the past 50 years. Deforestation represents the biggest threat to Pygmy Hippos, with forests within their historical range having been steadily logged, farmed, converted to plantations (rubber, coffee and oil palm) and settled (Christie et al. 2007, Norris et al. 2010). An increase in mining and associated infrastructure development in recent years further threatens the remaining forests. What forest that does remain is fragmented, leaving Pygmy Hippo populations isolated, with demographic consequences and the increased susceptibility of small populations to local extinction (Mallon et al. 2011). Fragmentation has made the forests more accessible for hunters and there is now very little, if any, undisturbed forest in the region safe for wildlife causing the Pygmy Hippo to retreat into the diminishing fragmented parcels of forest (Lewison and Oliver 2008).

We quantified loss of forest in the range of the species using the Hansen et al. (2013) forest cover change maps. We used 300 m resolution maps (resampled from the original 30 m resolution to enable calculations to be computationally tractable). We calculated the approximate area of forest cover within the non-extinct portions of the species range in year 2000 (71,435 km2). We then summed the proportional forest loss (negative) and gain (positive) values between 2000-2012, which resulted in an estimate of a 5,010 km2 reduction in forest cover within the range. Note that this calculation assumes that each loss is a 100% loss and each gain is a 100% gain within a pixel. We then rescaled the net loss to a 26-year period (two generations; Pacifici et al. 2013). The result is a conservatively estimated ~15% net loss in forest cover over two generations.

Although Pygmy Hippos are not generally a primary target for subsistence hunting, they are reported to be taken opportunistically by bushmeat hunters. There are also reports from some locations of Pygmy Hippos being by commercial hunters (e.g. Dufour 2002). They are killed predominantly for their meat and, unlike the Common Hippo, their teeth have little trade value, but many of their body parts, including the skull, may be used in rituals or traditional medicine (Robinson 1970, Hentschel 1990).

Whilst Pygmy Hippos are legally protected in all range countries, the level of enforcement is limited due to a lack of capacity in terms of human and financial resources and adequate training.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats to the Pygmy Hippopotamus include deforestation, hunting, agricultural land development, and civil conflicts. Although Pygmy Hippos are legally protected in most of the regions where they are found, there are few resources to enforce their protection and numbers in the wild continue to decrease.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Deforestation is the main threat facing the pygmy hippopotamus (2). Hunting is also known to occur, but the extent of this has not been determined (2). The subspecies C. l. heslopi in Nigeria may already be extinct (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is included on Appendix II of CITES (as Hexaprotodon liberiensis). It has full legal protection in all range state countries.

Remaining Pygmy Hippo populations are primarily found inside protected areas (Mallon et al. 2011). Effective protection and management of protected areas is therefore key to the persistence and conservation of pygmy hippos. The largest protected area containing Pygmy Hippos is Ta National Park and its Zone of Protection in Cte dIvoire. Other important sites are Sapo National Park, Grebo National Forest, Gola National Forest and Wonegizi proposed protected area in Liberia, the Gola Rainforest National Park, Tiwai Wildlife Sanctuary and Loma Mountains Forest Reserve in Sierra Leone, and Ziama Biosphere Reserve, Dick and Mont Bro Reserves in Guinea. Due to the fragmented nature of these remaining populations it will be important to ensure corridors are maintained between sites.

In November 2010 the Pygmy Hippo sub-group of the IUCN SSC Hippo Specialist Group and the Zoological Society of London convened a workshop in Monrovia, Liberia, to develop a Regional Pygmy Hippo Conservation Strategy to guide conservation and research activities related to the Pygmy Hippo. This was attended by representatives from government agencies, local and international NGOs, academic institutions and Pygmy Hippo experts from all the range states and internationally. This strategy, published in 2011, identifies objectives and priority actions needed to address the threats to the pygmy hippos and halt their decline (Mallon et al. 2011).

In December 2012, the Liberias Forestry Development Authority and Fauna & Flora International hosted a national action planning meeting during which an Action Plan for the Conservation of the Pygmy Hippo in Liberia was produced. The action plan adopts the same Vision and Goal as the Regional Pygmy Hippo Conservation Strategy and articulates objectives necessary to attain these in Liberia and necessary actions required to achieve these (FFI and FDA 2013).

There are now conservation and/or research initiatives directly or indirectly targeting Pygmy Hippos in all four range countries. Details of these are found in the Regional Pygmy Hippo Conservation Strategy (Mallon et al. 2011).

Captive Breeding
As of 31 December 2013, the International Studbook for the Pygmy Hippopotamus records 353 living Pygmy Hippopotami kept in 133 institutions (Steck 2014). The age structure is, however, not very healthy. There is a lack of young animals and the sex ratio is skewed (38.53% males and 58.64% females, 2.83% unknown). 30-day mortality in both sexes is high: 33% in both sexes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Direct conservation action is required to prevent precipitous declines and potential extinction (7). At present there is a good captive population, which has bred successfully in captivity and has doubled in size over the last 25 years (2). If the wild population becomes extinct, it should be possible to maintain the species in captivity, providing a last-ditch safeguard against total extinction (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of Hexaprotodon liberiensis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pygmy hippos are hunted as a source of bushmeat.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pygmy hippopotamus

The pygmy hippopotamus (Choeropsis liberiensis or Hexaprotodon liberiensis) is a small hippopotamid native to the forests and swamps of West Africa, primarily in Liberia and small populations in Sierra Leone, Guinea and Ivory Coast. The pygmy hippo is reclusive and nocturnal. It is one of only two extant species in the Hippopotamidae family, the other being its much larger cousin the common hippopotamus (Hippopotamus amphibius).

The pygmy hippopotamus displays many terrestrial adaptations, but like its larger cousin, it is semi-aquatic and relies on proximity to water to keep its skin moisturized and its body temperature cool. Behaviors such as mating and giving birth may occur in water or on land. The pygmy hippo is herbivorous, feeding on ferns, broad-leaved plants, grasses and fruits it finds in the forests.

A rare nocturnal forest creature, the pygmy hippopotamus is a difficult animal to study in the wild. Pygmy hippos were unknown outside of West Africa until the 19th century. Introduced to zoos in the early 20th century, they breed well in captivity and the vast majority of research is derived from zoo specimens. The survival of the species in captivity is more assured than in the wild; the World Conservation Union estimates that there are fewer than 3,000 pygmy hippos remaining in the wild.[1]

Pygmy hippos are primarily threatened by loss of habitat, as forests are logged and converted to farm land, and are also vulnerable to poaching, hunting for bushmeat, natural predators and war. Pygmy hippos are among the species illegally hunted for food in Liberia.[3]

Taxonomy and origins[edit]

Nomenclature of the pygmy hippopotamus reflects that of the hippopotamus. The plural form is pygmy hippopotami (hippopotamuses is also accepted as a plural form by the OED, or pygmy hippos for short). A male pygmy hippopotamus is known as a bull, a female as a cow, and a baby as a calf. A group of hippopotami is known as a herd or a bloat.[4]

The skull of a pygmy hippopotamus.

The pygmy hippopotamus is a member of the family Hippopotamidae where it is classified as a member of either the genus Choeropsis ("resembling a hog") or, the genus Hexaprotodon ("six front teeth"). Members of Hippopotamidae are sometimes known as hippopotamids. Sometimes the sub-family Hippopotaminae is used. Further, some taxonomists group hippopotami and anthracotheres in the superfamily Anthracotheroidea or Hippopotamoidea.

A sister species of the pygmy hippopotamus may have been the little-studied Malagasy pygmy hippopotamus (Hexaprotodon madagascariensis or Hippopotamus madagascariensis), one of three recently extinct species from Madagascar. C. madagascariensis was the same size as C. liberiensis and shared its terrestrial behavior, inhabiting the forested highlands of Madagascar, rather than open rivers. It is believed to have gone extinct within the last 500 years.[5][6][7]

The taxonomy of the genus of the pygmy hippopotamus has changed as understanding of the animal has developed.[1][8][9][10] Samuel G. Morton initially classified the animal as Hippopotamus minor, but later determined it was distinct enough to warrant its own genus, and labeled it Choeropsis. In 1977, Coryndon proposed that the pygmy hippopotamus was closely related to Hexaprotodon, a genus that consisted of prehistoric hippos mostly native to Asia.[11]

This assertion was widely accepted,[1][8][9][10] until Boisserie asserted in 2005 that the pygmy hippopotamus was not a member of Hexaprotodon, after a thorough examination of the phylogeny of Hippopotamidae. He suggested instead that the pygmy hippopotamus was a distinct genus, and returned the animal to Choeropsis.[8][12][13] All agree that the modern pygmy hippopotamus, be it H. liberiensis or C. liberiensis, is the only extant member of its genus.[8][11]

Nigerian subspecies[edit]

A distinct subspecies of pygmy hippopotamus lived in Nigeria until at least the 20th century, though the validity of this has been questioned.[1] The existence of the subspecies, makes Choeropsis liberiensis liberiensis (or Hexaprotodon liberiensis liberiensis under the old classification) the full trinomial nomenclature for the Liberian pygmy hippopotamus. The Nigerian pygmy hippopotamus was never studied in the wild and never captured. All research and all zoo specimens are the Liberian subspecies. The Nigerian subspecies is classified as C. liberiensis heslopi.[9]

The Nigerian pygmy hippopotamus ranged in the Niger River Delta, especially near Port Harcourt, but no reliable reports exist after the collection of the museum specimens secured by I. R. P. Heslop, a British colonial officer, in the early 1940s. It is probably extinct.[1] The subspecies is separated by over 1,800 km (1,100 mi) and the Dahomey Gap, a region of savanna that divides the forest regions of West Africa. The subspecies is named after I. R. P. Heslop, who claimed in 1945 to have shot a pygmy hippo in the Niger Delta region and collected several skulls. He estimated that perhaps no more than 30 pygmy hippos remained in the region.[14]

Heslop reportedly sent four pygmy hippopotamus skulls he collected to the British Museum of Natural History in London. These specimens were not subjected to taxonomic evaluation, however, until 1969 when G. B. Corbet classified the skulls as belonging to a separate subspecies based on consistent variations in the proportions of the skulls.[15] The Nigerian pygmy hippos were seen or shot in Rivers State, Imo State and Bayelsa State, Nigeria. While some local populations are aware that the species once existed, its history in the region is poorly documented.[9]

Evolution[edit]

Anthracotheres like Anthracotherium resembled pygmy hippos and are among their likely ancestors.

The evolution of the pygmy hippopotamus is most often studied in the context of its larger cousin. Both species were long believed to be most closely related to the family Suidae (pigs and hogs) or Tayassuidae (peccaries), but research within the last 10 years has determined that pygmy hippos and hippos are most closely related to cetaceans (whales and dolphins). Hippos and whales shared a common semi-aquatic ancestor that branched off from other artiodactyls around 60 mya.[16][17]

This hypothesized ancestor likely split into two branches about six million years later.[18] One branch would evolve into cetaceans, the other branch became the anthracotheres, a large family of four-legged beasts, whose earliest member, from the Late Eocene, would have resembled narrow hippopotami with comparatively small and thin heads.[12]

Hippopotamids are deeply nested within the family Anthracotheriidae. The oldest known hippopotamid is the genus Kenyapotamus, which lived in Africa from 16 to 8 mya. Kenyapotamus is known only through fragmentary fossils, but was similar in size to C. liberiensis.[13] The Hippopotamidae are believed to have evolved in Africa, and while at one point the species spread across Asia and Europe, no hippopotami have ever been discovered in the Americas. Starting 7.5 to 1.8 mya the Archaeopotamus, likely ancestors to the genus Hippopotamus and Hexaprotodon, lived in Africa and the Middle East.[8]

While the fossil record of hippos is still poorly understood, the lineages of the two modern genera, Hippopotamus and Choeropsis, may have diverged as far back as 8 mya. The ancestral form of the pygmy hippopotamus may be the genus Saotherium. Saotherium and Choeropsis are significantly more basal than Hippopotamus and Hexaprotodon, and thus more closely resemble the ancestral species of hippos.[8][13]

Extinct pygmy and dwarf hippos[edit]

Several species of small hippopotamids have also become extinct in the Mediterranean in the late Pleistocene or early Holocene. Though these species are sometimes known as "pygmy hippopotami" they are not believed to be closely related to C. liberiensis. These include the Cretan dwarf hippopotamus (Hippopotamus creutzburgi), the Sicilian hippopotamus (Hippopotamus pentlandi), the Maltese hippopotamus (Hippopotamus melitensis) and the Cyprus dwarf hippopotamus (Hippopotamus minor).[19]

These species, though comparable in size to the pygmy hippopotamus, are considered dwarf hippopotamuses, rather than pygmies. They are likely descended from a full-sized species of European hippopotamus, and reached their small size through the evolutionary process of insular dwarfism which is common on islands; the ancestors of pygmy hippopotami were also small and thus there was never a dwarfing process.[19] There were also several species of pygmy hippo on the island of Madagascar (see Malagasy hippopotamus).

Description[edit]

A pygmy hippopotamus resting at Louisville Zoo. The skull of a pygmy hippo has less pronounced orbits and nostrils than a common hippopotamus.

Pygmy hippos share the same general form as a hippopotamus. They have a graviportal skeleton, with four stubby legs and four toes on each foot, supporting a portly frame. The pygmy hippo, however, is only half as tall as the hippopotamus and weighs less than 1/4 as much as its larger cousin. Adult pygmy hippos stand about 75–100 cm (2.46–3.28 ft) high at the shoulder, are 150–175 cm (4.92–5.74 ft) in length and weigh 180–275 kg (397–606 lb).[20] Their lifespan in captivity ranges from 30 to 55 years, though it is unlikely that they live this long in the wild.[9][21]

The skin is greenish-black or brown, shading to a creamy gray on the lower body. Their skin is very similar to the common hippo's, with a thin epidermis over a dermis that is several centimeters thick. Pygmy hippos have the same unusual secretion as common hippos, that gives a pinkish tinge to their bodies, and is sometimes described as "blood sweat" though the secretion is neither sweat nor blood. The highly alkaline substance is believed to have antiseptic and sunscreening properties. The skin of hippos dries out quickly and cracks, which is why both species spend so much time in water.[9]

The skeleton of C. liberiensis is more gracile than that of the common hippopotamus, meaning their bones are proportionally thinner. The common hippo's spine is parallel with the ground; the pygmy hippo's back slopes forward, a likely adaptation to pass more easily through dense forest vegetation. Proportionally, the pygmy hippo's legs and neck are longer and its head smaller.

A nuzzling couple at the Duisburg Zoo in Germany.

The orbits and nostrils of a pygmy hippo are much less pronounced, an adaptation from spending less time in deep water (where pronounced orbits and nostrils help the common hippo breathe and see). The feet of pygmy hippos are narrower, but the toes are more spread out and have less webbing, to assist in walking on the forest floor.[21]

Despite adaptations to a more terrestrial life than the common hippopotamus, pygmy hippos are still more aquatic than all other even-toed ungulates. The ears and nostrils of pygmy hippos have strong muscular valves to aid submerging underwater, and the skin physiology is dependent on the availability of water.[9][10]

Behavior[edit]

(video) Bathing in a Japanese zoo.

The behavior of the pygmy hippo differs from the common hippo in many ways. Much of its behavior is more similar to that of a tapir, though this is an effect of convergent evolution.[10] While the common hippopotamus is gregarious, pygmy hippos live either alone or in small groups, typically a mated pair or a mother and calf. Pygmy hippos tend to ignore each other rather than fight when they meet. Field studies have estimated that male pygmy hippos range over 1.85 km2 (460 acres), while the range of a female is 0.4 to 0.6 km2 (99–148 acres).[9]

Pygmy hippos spend most of the day hidden in rivers. They will rest in the same spot for several days in a row, before moving to a new spot. At least some pygmy hippos make use of dens or burrows that form in river banks. It is unknown if the pygmy hippos help create these dens, or how common it is to use them. Though a pygmy hippo has never been observed burrowing, other artiodactyls, such as warthogs, are burrowers.[9]

Diet[edit]

Like the common hippopotamus, the pygmy hippo emerges from the water at dusk to feed. It relies on game trails to travel through dense forest vegetation. It marks trails by vigorously waving its tail while defecating to further spread its feces. The pygmy hippo spends about six hours a day foraging for food.[9]

Pygmy hippos are herbivorous. They do not eat aquatic vegetation to a significant extent and rarely eat grass because it is uncommon in the thick forests they inhabit. The bulk of a pygmy hippo's diet consists of ferns, broad-leaved plants and fruits that have fallen to the forest floor. The wide variety of plants pygmy hippos have been observed eating suggests that they will eat any plants available. This diet is of higher quality than that of the common hippopotamus.[9]

Reproduction[edit]

Baby pygmy hippopotamus stands near its parent at a zoo in Jihlava, Czech Republic.

A study of breeding behavior in the wild has never been conducted; the artificial conditions of captivity may cause the observed behavior of pygmy hippos in zoos to differ from natural conditions. Sexual maturity for the pygmy hippopotamus occurs between three and five years of age.[10] The youngest reported age for giving birth is a pygmy hippo in the Zoo Basel, Switzerland which bore a calf at three years and three months.[9] The oestrus cycle of a female pygmy hippo lasts an average of 35.5 days, with the oestrus itself lasting between 24–48 hours.[1][22]

Pygmy hippos consort for mating, but the duration of the relationship is unknown. In zoos they breed as monogamous pairs. Copulation can take place on land or in the water, and a pair will mate one to four times during an oestrus period. In captivity, pygmy hippos have been conceived and born in all months of the year.[10] The gestation period ranges from 190–210 days, and usually a single young is born, though twins are known to occur.[9]

The common hippopotamus gives birth and mates only in the water, but pygmy hippos mate and give birth on both land and water. Young pygmy hippos can swim almost immediately. At birth, pygmy hippos weigh 4.5–6.2 kg (9.9–13.7 lb) with males weighing about 0.25 kg (0.55 lb) more than females. Pygmy hippos are fully weaned between six and eight months of age; before weaning they do not accompany their mother when she leaves the water to forage, but instead hide in the water by themselves. The mother returns to the hiding spot about three times a day and calls out for the calf to suckle. Suckling occurs with the mother lying on her side.[9]

Conservation[edit]

A pair of pygmy hippos at the Mount Kenya Wildlife Conservancy.

The greatest threat to the remaining pygmy hippopotamus population in the wild is loss of habitat. The forests in which pygmy hippos live have been subject to logging, settling and conversion to agriculture, with little efforts made to make logging sustainable. As forests shrink, the populations become more fragmented, leading to less genetic diversity in the potential mating pool.[1]

Pygmy hippos are among the species illegally hunted for food in Liberia.[3] Their meat is said to be of excellent quality, like that of a wild boar; unlike those of the common hippo, the pygmy hippo's teeth have no value.[10] The effects of West Africa's civil strife on the pygmy hippopotamus are unknown, but unlikely to be positive.[1] The pygmy hippopotamus is capable of being killed by leopards, pythons and crocodiles. How often this occurs is unknown.[9]

C. liberiensis was identified as one of the top-10 "focal species" in 2007 by the Evolutionarily Distinct and Globally Endangered (EDGE) project.[23] Some populations inhabit protected areas, such as the Gola Forest Reserve in Sierra Leone.[24]

The Zoo Basel in Switzerland holds the international studbook and coordinates the entire captive pygmy hippo population that freely breeds in zoos around the world. Between 1970 and 1991 the population of pygmy hippos born in captivity more than doubled. The survival of the species in zoos is more certain than the survival of the species in the wild.[21][25] In captivity, the pygmy hippo lives from 42 to 55 years, longer than in the wild.[9] Since 1919, only 41 percent of pygmy hippos born in zoos have been male.[22]

History and folklore[edit]

A pair of pygmy hippos at the Mount Kenya Wildlife Conservancy.

While the common hippopotamus was known to Europeans since classical antiquity, the pygmy hippopotamus was unknown outside of its range in West Africa until the 19th century. Due to their nocturnal, forested existence, they were poorly known within their range as well. In Liberia the animal was traditionally known as a water cow.[10]

Early field reports of the animal misidentified it as a wild hog. Several skulls of the species were sent to the American natural scientist Samuel G. Morton, during his residency in Monrovia, Liberia. Morton first described the species in 1843. The first complete specimens were collected as part of a comprehensive investigation of Liberian fauna in the 1870s and 1880s by Dr. Johann Büttikofer. The specimens were taken to the Natural History Museum in Leiden, The Netherlands.[10]

The first pygmy hippo was brought to Europe in 1873 after being captured in Sierra Leone by a member of the British Colonial Service but died shortly after arrival. Pygmy hippos were successfully introduced to Europe in 1911. They were first shipped to Germany and then to the Bronx Zoo in New York City where they also thrived.[9][10]

In 1927, Harvey Firestone of Firestone Tires presented Billy the pygmy hippo to U.S. President Calvin Coolidge. Coolidge donated Billy to the National Zoo in Washington, D.C. According to the zoo, Billy is a common ancestor to most pygmy hippos in U.S. zoos today.[21][26]

Several folktales have been collected about the pygmy hippopotamus. One tale says that pygmy hippos carry a shining diamond in their mouths to help travel through thick forests at night; by day the pygmy hippo has a secret hiding place for the diamond, but if a hunter catches a pygmy hippo at night the diamond can be taken. Villagers sometimes believed that baby pygmy hippos do not nurse but rather lick secretions off the skin of the mother.[10]

References[edit]

  1. ^ a b c d e f g h i j Lewison, R. & Oliver, W. (IUCN SSC Hippo Specialist Subgroup) (2008). Hexaprotodon liberiensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 17 December 2006. Database entry includes a brief justification of why this species is of endangered.
  2. ^ "ITIS on Hexaprotodon liberiensis". Integrated Taxonomic Information System. Retrieved 2004-08-11. 
  3. ^ a b "Poaching in Liberia's Forests Threatens Rare Animals", Anne Look, Voice of America News, May 08, 2012.
  4. ^ List of animal names
  5. ^ Harris, J.M. (1991). "Family Hippopotamidae". Koobi Fora Research Project. Vol. 3. the Fossil Ungulates: Geology, Fossil Artiodactyls and Paleoenvironments (Clarendon Press, Oxford): 31–85. 
  6. ^ Oliver, W.L.R. (1995). "Taxonomy and Conservation Status of the Suiformes — an Overview" (PDF). IBEX Journal of Mountain Ecology. 
  7. ^ "Hippopotamus madagascariensis". IUCN Red List of Threatened Species. 2002. Retrieved 2008-08-23. 
  8. ^ a b c d e f Boisserie, Jean-Renaud (2005). "The phylogeny and taxonomy of Hippopotamidae (Mammalia: Artiodactyla): a review based on morphology and cladistic analysis". Zoological Journal of the Linnean Society 143: 1–26. doi:10.1111/j.1096-3642.2004.00138.x. 
  9. ^ a b c d e f g h i j k l m n o p q Eltringham, S. Keith (1999). The Hippos. London: Academic Press. ISBN 0-85661-131-X. 
  10. ^ a b c d e f g h i j k Robinson, Phillip T. River Horses and Water Cows. Hippo Specialist Group of the World Conservation Union. Retrieved on 2007-07-30.
  11. ^ a b "The taxonomy and nomenclature of the Hippopotamidae (Mammalia, Artiodactyla) and a description of two new fossil species". Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen 80 (2): 61–88. 1977. 
  12. ^ a b Boisserie, Jean-Renaud; Fabrice Lihoreau; Michel Brunet (February 2005). "The position of Hippopotamidae within Cetartiodactyla". Proceedings of the National Academy of Sciences 102 (5): 1537–1541. doi:10.1073/pnas.0409518102. PMC 547867. PMID 15677331. 
  13. ^ a b c Boisserie, Jean-Renaud; Fabrice Lihoreau; Michel Brunet (March 2005). "Origins of Hippopotamidae (Mammalia, Cetartiodactyla): towards resolution". Zoologica Scripta 34 (2): 119–143. doi:10.1111/j.1463-6409.2005.00183.x. 
  14. ^ "Pigs, Peccaries and Hippos Status Survey and Action Plan". World Conservation Union status survey. 1993. Archived from the original on January 5, 2008. Retrieved 2008-08-23. 
  15. ^ Corbet, G. B. (1969). "The taxonomic status of the pygmy hippopotamus, Choeropsis liberiensis, from the Niger Delta". Journal of Zoology 158: 387–394. doi:10.1111/j.1469-7998.1969.tb02156.x. 
  16. ^ "Scientists find missing link between the dolphin, whale and its closest relative, the hippo". Science News Daily. 2005-01-25. Retrieved 2008-08-23. 
  17. ^ Gatesy, J (1 May 1997). "More DNA support for a Cetacea/Hippopotamidae clade: the blood-clotting protein gene gamma-fibrinogen". Molecular Biology and Evolution 14 (5): 537–543. doi:10.1093/oxfordjournals.molbev.a025790. PMID 9159931. 
  18. ^ Ursing, B.M.; U. Arnason (1998). "Analyses of mitochondrial genomes strongly support a hippopotamus-whale clade". Proceedings of the Royal Society 265 (1412): 2251–5. doi:10.1098/rspb.1998.0567. PMC 1689531. PMID 9881471. 
  19. ^ a b Petronio, C. (1995). "Note on the taxonomy of Pleistocene hippopotamuses" (PDF). Ibex 3: 53–55. Retrieved 2008-08-23. 
  20. ^ Macdonald, D. (2001). The New Encyclopedia of Mammals. Oxford University Press, Oxford. ISBN 0198508239. 
  21. ^ a b c d "Pygmy Hippo fact sheet". National Zoological Park. Retrieved 2008-08-23. 
  22. ^ a b Zschokke, Samuel (2002). "Distorted Sex Ratio at Birth in the Captive Pygmy Hippopotamus, Hexaprotodon Liberiensis". Journal of Mammalogy 83 (3): 674–681. doi:10.1644/1545-1542(2002)083<0674:DSRABI>2.0.CO;2. 
  23. ^ "Protection for 'weirdest' species". BBC. 2007-01-16. Retrieved 2008-08-23. 
  24. ^ Visitsierraleone.org
  25. ^ Eltringham, S. Keith (1993). "Pigs, Peccaries and Hippos Status Survey and Action Plan". IUCN. Archived from the original on January 5, 2008. 
  26. ^ Jablonski, Nina G. (2004). "The hippo’s tale: how the anatomy and physiology of Late Neogene Hexaprotodon shed light on Late Neogene environmental change". Quaternary International 117: 119–123. doi:10.1016/S1040-6182(03)00121-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!