Dasyurus hallucatus Gould, 1842

Northern Quoll


Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: Endangered (EN) external link Showing: scientific names

Media Center Navigation








Classification : Text | Graphic |

Barcode

Barcode data

Source and Additional Information
Location
Citation

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 

GBMA0380-06|AY795973|Dasyurus hallucatus|

ACTCGATGACTTTTCTCTACAAATCATAAAGACATCGGAACTCTTTACCTATTATTTGGGGCTTGAGCAGGTATAACTGGCACAGCATTA---AGTCTTCTAATTCGAGCTGAACTCGGTCAGCCAGGTACTCTTATTGGTGAT---GATCAAATTTATAATGTTATCGTTACAGCCCATGCCTTTGTAATAATTTTCTTTATAGTAATACCCATTATGATTGGAGGTTTTGGTAACTGGTTAGTCCCTCTAATG---ATCGGGGCTCCTGATATAGCATTCCCTCGAATAAATAATATGAGTTTCTGACTGTTACCACCATCATTCTTACTTCTTTTAGCATCCTCAACCGTTGAAGCTGGTGCTGGGACCGGGTGAACAGTCTATCCTCCTTTAGCAGGCAACCTTGCCCACGCAGGAGCATCCGTTGATCTG---GCTATTTTCTCCCTCCACTTAGCAGGAGTTTCATCTATTCTAGGCGCTATTAACTTTATTACCACTATTATTAACATAAAACCCCCTGCAATGTCTCAATATCAAACGCCTCTATTCGTTTGATCTGTGATAATTACAGCAGTTCTACTTCTACTCTCACTACCTGTTCTCGCAGCA---GGCATCACAATATTACTAACTGACCGCAACCTTAATACAACATTTTTCGACCCTGCCGGTGGAGGTGATCCTATTCTATATCAACATCTGTTCTGATTTTTTGGTCACCCTGAAGTCTACATCCTAATCTTACCAGGGTTTGGTATAATCTCTCATATCGTTACTTACTATGCAGGTAAAAAA---GAACCTTTTGGCTATATAGGAATAGTTTGAGCAATAATATCAATTGGCTTTCTAGGCTTTATTGTATGAGCTCACCATATATTCACTGTAGGACTAG


 
-- end --
 


Download FASTA File
"Dasyurus hallucatus Gould, 1842". Encyclopedia of Life, available from "http://www.eol.org/pages/323725". Accessed 14 Mar 2010.