Isoodon macrourus (Gould, 1842)

Northern Brown Bandicoot


Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: Least Concern (LC) external link Showing: scientific names

Media Center Navigation








Barcode

Barcode data

Source and Additional Information

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 

GBMA0052-06|AF358864|Isoodon macrourus|

AACCGTTGACTATTCTCAACTAATCATAAAGATATTGGCACCCTATATCTTCTATTTGGTGCCTGAGCAGGGATAGTAGGGACTGCTCTG---AGCTTGTTAATCCGAGCAGAACTTGGCCAACCCGGAACATTACTTGGAGAT---GACCAGATCTACAATGTAATTGTTACTGCTCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGCTTCGGAAACTGACTTGTTCCTCTAATA---ATTGGTGCTCCCGATATAGCTTTCCCACGAATAAATAATATAAGCTTCTGACTTCTTCCACCATCATTTCTACTACTTTTAGCTTCATCTACAGTTGAAGCAGGGGCAGGTACAGGATGAACTGTATATCCCCCATTAGCAGGAAATCTTGCCCACGCAGGAGCCTCTGTAGATCTA---GCCATCTTCTCCCTTCATCTAGCCGGTATTTCATCAATTTTAGGAGCAATTAACTTTATTACAACAATCATTAATATAAAACCACCAGCAATATCACAATATCAAACCCCTTTATTTGTTTGATCGGTAATAATTACTGCAGTATTATTGCTCCTATCATTACCAGTACTAGCAGCA---GGAATTACTATACTACTTACTGATCGTAACCTAAATACAACTTTCTTTGACCCTGCAGGTGGCGGAGACCCTATTCTTTATCAACATCTATTTTGATTCTTTGGTCATCCTGAAGTCTATATTCTTATTTTACCCGGATTTGGTATAATCTCTCATATTGTCACTTATTACTCAGGTAAAAAA---GAACCATTCGGATATATAGGAATAGTTTGAGCCATAATATCAATTGGGTTCCTAGGATTTATCGTTTGAGCCCACCATATGTTTACAGTAGGATTAG


 
-- end --
 


Download FASTA File
"Isoodon macrourus (Gould, 1842)". Encyclopedia of Life, available from "http://www.eol.org/pages/323866". Accessed 22 Mar 2010.