Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Overview

Distribution

Range Description

Vespertilio murinus has a wide distribution in the northern Palaearctic, from France, Britain and the Netherlands in the west through central, northern, and eastern Europe and Siberia to the Pacific coast. In the Mediterranean region this species occurs from southeastern France eastwards through northern Italy and Switzerland into most of the Balkans. There are scattered records from Turkey. In Japan, it has only been recorded from Rebun Island in 2002 (Abe, et al., 2005). The northern limit is above 60°N in Fennoscandia and ca. 63°N in Russia, and the southern limit of its range passes through the Balkan peninsula, northern Iran, central Asia, Afghanistan, northern Pakistan, and China. The southern records refer to wintering individuals, and the westernmost records refer to vagrants. Breeding is restricted to the northern part of the range in this migratory species. It occurs from sea level to 3,400 m asl (Molur et al. 2002)

In Mongolia, it was first recorded in 1964 in Shargyn Govi in Mongol Altai Mountain Range (Stubbe and Chotolchu, 1968), currently distributed throughout Mongolia including Hentii and Hangai mountain ranges (Tinnin et al., 2002), and Valley of the Lakes (Sokolov and Orlov, 1980). In China, the subspecies V. m. murinus Linnaeus, 1758 occurs in the provinces of Xinjiang (northwest China) and Gansu (central China), and V. m. ussuriensis Wallin, 1969 occurs in the provinces of Nei Mongol and Heilongjiang.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It forages in open areas over various habitat types (forest, semi-desert, urban, steppe, agricultural land). It feeds on moths and beetles. Summer roosts tend to be situated in houses or other buildings; also rarely hollow trees, nest boxes, or rock crevices. Winter roost sites include rock fissures, often (as substitute) crevices in tall buildings (including, or especially, in cities), occasionally tree holes or cellars. Winter roosts are usually in colder sites that are exposed to temperature changes. Migrations of up to 1,780 km have been recorded (Markovets et al. 2004), although the species is sedentary in a large part of its range. This nocturnal species appears late in the evening, sleeping in narrow crevices during the day. They live in small colonies and often single individuals are sighted. It hibernates throughout the winter. Young are born in June/July, generally 2 are born at a time, and are stuck onto the chest of the mother during flight. Feeds on small dipterans, beetles and moths.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / parasite / ectoparasite
Nycteribia kolenatii ectoparasitises Vespertilio murinus
Other: minor host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12 years Observations: Given the longevity of similar species, the maximum longevity in these animals appears underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vespertilio murinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTTTATTTACTATTTGGTGCTTGAGCTGGCATAGTGGGAACCGCACTAAGCCTCTTAATCCGAGCTGAATTAGGCCAGCCGGGAGCCCTACTTGGAGATGATCAGATTTACAACGTAATTGTAACCGCCCATGCTTTTGTAATAATTTTCTTTATAGTCATGCCTATTATAATTGGAGGCTTTGGGAACTGACTTGTTCCACTGATAATTGGAGCCCCCGATATGGCATTTCCCCGAATGAATAATATAAGCTTTTGACTCCTCCCTCCCTCTTTCCTATTACTCTTAGCCTCATCCATAGTAGAAGCAGGGGCCGGTACGGGCTGAACAGTATATCCCCCCTTAGCAGGAAATCTAGCCCATGCAGGAGCCTCTGTAGACCTGACTATTTTCTCTTTACATCTGGCAGGGGTGTCTTCAATTTTAGGCGCAATTAATTTTATTACCACGATCATTAATATAAAACCCCCAGCCCTCTCCCAATATCAAACTCCACTTTTTGTCTGATCAGTCCTTATTACAGCTGTTCTTCTTTTATTATCTCTTCCTGTACTAGCTGCCGGCATTACAATGCTATTGACAGACCGAAATTTGAATACAACTTTCTTCGACCCGGCTGGAGGAGGGGACCCTATTCTATATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vespertilio murinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Spitzenberger, F., Aulagnier, S., Coroiu, I., Stubbe, M., Ariunbold, J., Buuveibaatar, V., Dorjderem, S., Monkhzul, Ts., Otgonbaatar, M. & Tsogbadrakh, M.

Reviewer/s
Vié, J.-C. & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern, because this species has a large population size and a wide distribution. No declines in population size have been detected, and there are no known widespread major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
An abundant species in northern parts of its European range. Summer maternity colonies number 30-50 (exceptionally 200) females; males may also form large colonies in summer. In winter it usually occurs singly or in small groups (although clusters of up to 30 have been recorded). Populations are expanding in some parts of the range, for example Denmark (H. J. Baagøe pers. comm.) and the Netherlands (H.J.G.A. Limpens pers. comm.). This species has a wide distribution, but a low abundance within Mongolia (M. Stubbe pers. comm.).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species across its range. In Europe, although not a major threat, the species is affected by loss of, or disturbance to roosts in buildings.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by national legislation in most range states. There are also international legal obligations for its protection through the Bonn Convention (Eurobats) and Bern Convention, in parts of its range where these apply. It is included in Annex IV of EU Habitats and Species Directive. It occurs in several protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parti-coloured bat

The parti-coloured bat or rearmouse (Vespertilio murinus) is a species of vesper bat that lives in temperate Eurasia.

Description[edit]

Their twittering call, similar to a bird's call, are to be heard particularly in the autumn during the mating season. The parti-coloured bat has a body size of 4.8–6.4 centimetres (1.9–2.5 in) with a wingspan of 26–33 cm (10–13 in), and a weight of 11–24 grams (0.39–0.85 oz).[4] Its name is derived from its fur, which has two colours. Its back (dorsal side) is red to dark-brown, with silver-white-frosted hair. The ventral side is white or grey. The ears, wings and face are black or dark brown. The wings are narrow. The ears are short, broad and roundish. The highest known age is 12 years.

Behaviour[edit]

These bats hunt for their prey, for example mosquitoes, caddis flies and moths, with a wide range of ultrasonic sounds, but especially around 25–27 kHz.[5] They hunt after twilight at heights of around 20–40 metres (66–131 ft), for example in open landscape over streams and lakes and above forests or at street lights.[6] In cold weather, the bat may remain in its resting place.

There is not much known about the behaviour of parti-coloured bats, as they are quite rare. Female bats live in small groups, of about 50 animals, sometimes up to several hundred adult females. In Western Europe, male groups consist of about 250 animals and are found only during the spring and early summer. These bats migrate, and flights of up to 900 kilometres (560 mi) were found. The furthest migration was determined at 1,780 km (1,110 mi).[1]

Between October and March, the bats hibernate. They hibernate alone, and can bear temperatures down to −5 °C (23 °F).[7]

Reproduction and birth[edit]

Females form maternity roosts during May and July and generally give birth to twins.[7] After the pups are weaned, which takes less than six weeks,[7] females leave the maternity roost. Birth of the young is in western Europe around beginning of June.

Distribution[edit]

The parti-coloured bat occurs in Central and Western Europe and in Asia. Its natural habitat is mountains, steppes and forested areas, but in Western Europe, they can mainly be found in cities. The species is protected, as it is threatened by insecticides and changes in their habitat.

References[edit]

  1. ^ a b A. M. Hutson, F. Spitzenberger, S. Aulagnier, I. Coroiu, M. Stubbe, J. Ariunbold, V. Buuveibaatar, S. Dorjderem, T. Monkhzul, M. Otgonbaatar & M. Tsogbadrakh (2008). "Vespertilio murinus". IUCN Red List of Threatened Species. Version 2014.3. International Union for Conservation of Nature. Retrieved 16 December 2014. 
  2. ^ Carl Linnaeus (1758). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin) (10th ed.). Stockholm: Laurentius Salvius. p. 32. 
  3. ^ "Vespertilio murinus Linnaeus, 1758 - Parti-Coloured Bat". Natural History Museum. Retrieved 16 December 2014. 
  4. ^ "Rarities and vagrants" (PDF). Bat Conservation Trust. Retrieved 16 December 2014. 
  5. ^ Maja Zagmajster (2003). "Display song of parti-coloured bat Vespertilio murinus Linnaeus, 1758 (Chiroptera, Mammalia) in southern Slovenia and preliminary study of its variability" (PDF). Natura Sloveniae 5 (1): 27–41. 
  6. ^ S. M. Swift. "Bat species in Scotland" (PDF). Scottish Natural Heritage. Retrieved 16 December 2014. 
  7. ^ a b c Anne-Jifke Haarsma & Henk Siepel (2013). "Macro-evolutionary trade-offs as the basis for the distribution of European bats" (PDF). Animal Biology 63 (4). pp. 451–471. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!