Procavia capensis (Pallas, 1766)
Common Rock Hyrax
Species recognized by The Integrated Taxonomic Information System
, T Orrell (custodian) in 
Retrieving comments, please wait...
-
Animalia +
-
Chordata +
-
Mammalia +
-
Hyracoidea +
-
Procaviidae +
-
Procavia +
-
Procavia capensis (Pallas, 1766)
- Procavia capensis capensis (Pallas, 1766) +
- Procavia capensis bamendae Brauer, 1913 +
- Procavia capensis capillosa Brauer 1917 +
- Procavia capensis erlangeri Neumann, 1901 +
- Procavia capensis habessinicus (Hemprich and Ehrenberg, 1832) +
- Procavia capensis jacksoni Thomas, 1900 +
- Procavia capensis jayakari Thomas, 1892 +
- Procavia capensis johnstoni Thomas, 1894 +
- Procavia capensis kerstingi Matschie, 1899 +
- Procavia capensis mackinderi Thomas, 1900 +
- Procavia capensis matschiei Neumann, 1900 +
- Procavia capensis pallida Thomas, 1891 +
- Procavia capensis ruficeps (Hemprich & Ehrenberg 1832) +
- Procavia capensis scioanus (Giglioli, 1888) +
- Procavia capensis sharica Thomas and Wroughton, 1907 +
- Procavia capensis syriacus (Schreber, 1784) +
- Procavia capensis welwitschii (Gray, 1868) +
-
Procavia capensis (Pallas, 1766)
-
Procavia +
-
Procaviidae +
-
Hyracoidea +
-
Mammalia +
-
Chordata +
-
Archaea +
-
Bacteria +
-
Chromista +
-
Fungi +
-
Plantae +
-
Protozoa +
-
Viruses +
Table of Contents
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
- Add New Content
Barcode
Barcode data
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACCGTTGATTGTTTTCAACCAACCATAAAGACATCGGCACTTTGTACTTACTATTTGGAGCTTGAGCTGGAATAGTAGGAACCGCCCTA---AGCATCCTAATCCGGGCCGAACTCGGCCAACCAGGAGCCCTACTGGGAGAT---GATCAAATCTACAACGTTGTAGTTACAGCTCACGCATTTGTAATAATTTTCTTCATAGTAATGCCAATTATAATCGGAGGGTTCGGCAACTGACTAGTCCCCTTAATA---ATTGGCTCCCCGGATATAGCATTCCCACGAATAAACAACATGAGCTTCTGACTATTACCCCCATCCTTTCTACTTCTGCTAGCCTCTTCTATAGTAGAAGCCGGAGCAGGAACAGGCTGAACAGTATACCCGCCTCTGGCGGGTAATTTAGCCCACGCAGGGGCCTCTGTAGACCTT---ACAATCTTCTCACTACACCTAGCAGGGGTTTCCTCAATCTTAGGGGCTATCAACTTCATCACCACTATCATTAACATAAAACCCCCAGCAACCACCCAATACCAAACACCCCTATTCGTTTGATCCGTACTAATCACTGCTGTACTCCTTTTATTATCCCTACCAGTGCTAGCAGCC---GGAATTACAATACTACTAACAGATCGAAACATCAACACAACCTTTTTCGACCCAGCGGGTGGAGGAGACCCAGTTCTATACCAACATCTATTCTGATTCTTCGGACACCCTGAAGTTTACATCCTCATTTTACCCGGATTTGGAATAATCTCCCACATTGTCACCTACTACTCAGGCAAAAAA---GAACCTTTCGGTTACATAGGTATGGTATGAGCCATAATATCAATTGGCTTCTTAGGATTTATTGTATGAGCTCACCATATATTCACAGTGGGAATAG
-- end --
Download FASTA File
Loading curation controls, please wait...
