Arctocephalus forsteri (Lesson, 1828)

New Zealand fur seal


Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: Least Concern (LC) external link Showing: scientific names

Media Center Navigation


Arctocephalus forsteri (Lesson, 1828)

Images


Items in yellow are not reviewed.

Choose images

Arctocephalus forsteri (Lesson, 1828)
Arctocephalus forsteri Lesson, 1828
Arctocephalus forsteri Lesson, 1828
Arctocephalus forsteri Lesson, 1828
Arctocephalus forsteri Lesson, 1828
Arctocephalus forsteri Lesson, 1828
Arctocephalus forsteri Lesson, 1828
Arctocephalus forsteri (Lesson, 1828)
Arctocephalus forsteri (Lesson, 1828)

Page navigation

Page 1 Next





Classification : Text | Graphic |

Barcode

Barcode data

Source and Additional Information
Location
Citation

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
 

GBMA0572-06|NC_004023|Arctocephalus forsteri|

AATCGATGATTATTCTCCACAAACCATAAAGATATTGGCACCCTCTATTTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTT---AGCCTATTGATCCGCGCGGAGTTAGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATCTACAACGTAATTGTCACCGCCCACGCATTCGTAATAATCTTTTTTATGGTAATACCTATTATAATTGGGGGCTTTGGAAATTGATTAGTACCCCTAATA---ATTGGAGCCCCCGACATGGCATTTCCTCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTTCTACTACTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCAGGTACCGGATGAACAGTTTACCCTCCTCTAGCAGGAAATCTAGCCCATGCAGGAGCTTCCGTAGACTTA---ACTATTTTCTCCCTTCACCTGGCAGGAGTATCATCCATTCTGGGAGCCATCAACTTTATTACTACTATTATCAACATGAAACCCCCTGCTATATCCCAATACCAAACCCCTTTATTCGTGTGATCCGTACTAATCACAGCGGTACTACTTCTGCTATCCCTACCAGTCCTGGCAGCT---GGTATCACTATATTACTCACGGACCGAAATCTAAACACAACCTTCTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTGTATATTCTCATCCTACCAGGATTCGGGATAATCTCACACATCGTCACCTATTACTCAGGAAAAAAG---GAACCCTTTGGTTATATGGGAATAGTCTGAGCAATAATATCAATCGGCTTCTTAGGCTTTATCGTATGAGCACACCATATATTCACCGTAGGAATAG


 
-- end --
 


Download FASTA File
"Arctocephalus forsteri (Lesson, 1828)". Encyclopedia of Life, available from "http://www.eol.org/pages/328621". Accessed 21 Mar 2010.