Arctocephalus australis (Zimmermann, 1783)

South American fur seal

Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: Least Concern (LC) external link Showing: scientific names

Media Center Navigation

Arctocephalus australis (Zimmermann, 1783)

Images

Items in yellow are not reviewed.

Choose images

Arctocephalus australis
Arctocephalus australis
Arctocephalus australis (Zimmermann, 1783)
Arctocephalus australis (Zimmermann, 1783)
Arctocephalus australis (Zimmermann, 1783)
Arctocephalus australis (Zimmermann, 1783)
Arctocephalus australis (Zimmermann, 1783)
Arctocephalus australis (Zimmermann, 1783)
Otariidae Gray, 1825

Page navigation

Page 1 Next
Classification : Text | Graphic |
  

Table of Contents

Barcode

Barcode data

Source and Additional Information
Supplier
Barcode of Life Data Systems (BOLD) external link
Copyright
Some rights reserved external link
Compiler
Sujeevan Ratnasingham external link
Compiler
Paul D.N. Hebert external link
Location
Source URL
View original data object external link
Citation

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
 

GBMA0251-06|AY377150|Arctocephalus australis|

AATCGATGATTATTCTCCACAAACCATAAAGATATTGGCACCCTTTATCTACTATTCGGTGCATGAGCTGGAATGGCTGGCACCGCCCTC---AGCCTATTGATCCGCGCGGAGTTGGGCCAACCAGGCACTCTACTAGGAGAT---GACCAAATCTACAACGTAATTGTCACCGCCCATGCATTCGTGATAATCTTTTTCATGGTAATACCTATTATAATTGGGGGCTTTGGAAATTGATTAGTACCCCTAATA---ATTGGAGCCCCCGATATGGCATTTCCTCGAATAAACAACATAAGTTTCTGACTTCTACCCCCCTCCTTCCTACTACTACTAGCCTCTTCTCTAGTTGAAGCCGGCGCAGGTACCGGATGAACAGTTTACCCTCCCCTAGCAGGAAACCTAGCCCATGCAGGAGCTTCCGTAGACTTA---ACTATTTTCTCCCTTCACCTGGCAGGAGTATCATCTATTCTGGGAGCCATTAACTTTATTACTACTATTATCAACATGAAACCCCCTGCCATATCCCAATACCAAACCCCTTTATTCGTGTGATCCGTACTAATCACAGCGGTACTACTTCTGCTATCCCTGCCAGTCCTGGCAGCT---GGTATCACTATATTACTTACGGACCGAAATCTAAACACAACCTTTTTTGATCCAGCCGGAGGGGGTGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTCATCCTACCAGGATTCGGGATAATCTCACACATCGTCACCTACTACTCAGGAAAAAAG---GAACCCTTTGGTTATATAGGAATAGTCTGAGCAATAATATCCATCGGCTTCTTAGGCTTTATCGTATGAGCACATCATATATTCACCGTAGGAATAG


 
-- end --
 


Download FASTA File
Katja Schulz. Curator. "Arctocephalus australis (Zimmermann, 1783)". Encyclopedia of Life, available from "http://www.eol.org/pages/328623". Accessed 19 Mar 2010.