Leptonychotes weddellii (Lesson, 1826)

Weddell seal


Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: Least Concern (LC) external link Showing: scientific names

Media Center Navigation


Leptonychotes weddellii (Lesson, 1826)

Images


Items in yellow are not reviewed.

Choose images

Leptonychotes weddellii (Lesson, 1826)
Leptonychotes weddellii (Lesson, 1826)
Leptonychotes weddellii (Lesson, 1826)
Phocidae Gray, 1821
Leptonychotes weddellii (Lesson, 1826)
Leptonychotes weddellii (Lesson, 1826)
Leptonychotes weddellii (Lesson, 1826)
Leptonychotes weddellii (Lesson, 1826)
Leptonychotes weddellii (Lesson, 1826)

Page navigation

Page 1 Next





Classification : Text | Graphic |

Barcode

Barcode data

Source and Additional Information
Location
Citation

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 

GBMA0238-06|AY377137|Leptonychotes weddellii|

AACCGATGACTATTTTCCACAAACCACAAAGATATTGGTACTCTCTATCTATTATTTGGTGCATGAGCCGGTATAGTAGGTACCGCCCTC---AGTCTTTTAATTCGCGCAGAACTAGGACAACCTGGTGCTTTACTAGGAGAT---GATCAGATTTATAACGTGATTGTCACCGCCCACGCATTCGTAATAATCTTTTTCATAGTAATACCTATCATAATCGGAGGCTTCGGAAACTGATTAGTACCCCTAATA---ATCGGCGCTCCTGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCTTACCGCCATCTTTCCTACTACTACTGGCCTCCTCCATAGTAGAAGCAGGCGCAGGAACAGGATGAACCGTATATCCTCCCTTAGCTGGTAACCTAGCCCACGCAGGAGCATCTGTAGACCTG---ACGATTTTCTCCCTTCACCTAGCAGGTGTATCATCCATCCTTGGGGCTATTAATTTCATCACTACTATCATCAATATAAAACCTCCTGCAATATCTCAATATCAAATTCCCCTATTCGTGTGATCCGTACTAATCACAGCAGTACTCCTACTACTATCACTACCAGTTCTAGCAGCT---GGCATTACTATACTACTTACAGATCGAAACCTGAATACAACATTCTTTGACCCCGCTGGAGGAGGGGATCCTATTCTATATCAACACCTATTCTGATTCTTTGGACATCCTGAAGTTTACATCCTAATCCTCCCAGGATTCGGAATGATTTCACATATCGTTACCTACTACTCAGGGAAAAAA---GAACCCTTTGGTTATATAGGAATAGTATGAGCAATAATATCCATCGGCTTCCTAGGTTTCATCGTATGGGCCCACCATATATTTACCGTAGGAATGG


 
-- end --
 


Download FASTA File
"Leptonychotes weddellii (Lesson, 1826)". Encyclopedia of Life, available from "http://www.eol.org/pages/328638". Accessed 20 Mar 2010.