Articles on this page are available in 1 other language: Chinese (Simplified) (2) (learn more)

Overview

Comprehensive Description

Summary

"
Habit

Colonial

Habitat

Spaces behind the old wooden boxes on wall, crevice in rocks

Niche

Crevices in temples, caves, deserted buildings. Up to 923m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

"
Global distribution

India, Myanmar, Sri Lanka

Known presence in Protected Areas

None

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Colonial
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

"
Habitat

Spaces behind the old wooden boxes on wall, crevice in rocks

Niche

Crevices in temples, caves, deserted buildings. Up to 923m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaerephon plicatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTCTATACCTCCTATTCGGCGCTTGAGCAGGAATAGTAGGAACCGCCCTAAGTCTTCTTATCCGAGCTGAATTAGGTCAGCCAGGAGCTCTCTTAGGAGACGATCAAATCTACAATGTAATTGTCACCGCCCATGCTTTCGTAATAATTTTCTTCATAGTAATACCCATTATAATTGGAGGCTTCGGAAATTGACTAGTCCCACTGATAATTGGTGCCCCCGATATAGCTTTCCCACGAATAAATAATATAAGCTTCTGACTCCTCCCTCCATCTTTCTTATTACTACTGGCCTCTTCCATAGTTGAGGCCGGGGCTGGAACAGGCTGAACAGTCTATCCTCCTTTAGCTGGAAATCTCGCCCATGCAGGAGCTTCCGTTGATTTAACCATCTTTTCACTACATCTAGCAGGTGTCTCTTCTATTCTAGGTGCTATCAATTTTATTACTACTATTATTAACATAAAACCACCAGCCCTCTCACAATACCAGACACCATTATTTGTATGATCTGTACTAATTACAGCTGTACTGCTCTTACTATCTCTACCAGTTTTAGCAGCTGGTATTACAATACTATTAACAGATCGAAATCTAAACACCACCTTCTTTGACCCTGCCGGAGGAGGAGACCCTATCCTATATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaerephon plicatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Stable in the past. Future trends not known.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

"Habitat loss, mining. The influence on the population well understood, not reversible and have not ceased to be a threat."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Risk Statement

"
Habitat status

Stable in area

Data quality

Field study, literature; Observed, inferred.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tadarida plicata


The Wrinkle-lipped free-tailed bat (Tadarida plicata) is a species of bat in the family Molossidae. It is distributed through most of Borneo, Indonesia, Philippines, China, and Hong-Kong to Pakistan, India and Sri Lanka.

Description[edit]

Head and body length is 6–7 cm. Forearms 4 cm.

Ears are connected across the forehead. General color is dark, slightly reddish brown above, lighter below. Distinct whitish band on sides of neck. Wings are long and the membrane is blackish brown. Fur sift, dense, and short.

Culture[edit]

Known as පොදු දිව් රැළි-තොල් වවුලා (meaning "common wrinkled-lipped bat") in Sinhala.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Wrinkle-lipped free-tailed bat

The wrinkle-lipped free-tailed bat (Chaerephon plicata) is a species of bat in the family Molossidae. It is found in Bangladesh, Bhutan, Cambodia, China, Cocos (Keeling) Islands, India, Indonesia, Laos, Malaysia, Myanmar, Nepal, the Philippines, Sri Lanka, Thailand, and Vietnam.

See also[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!