Overview

Distribution

British Isles; Atlantic coast of Europe; North Sea; Faroes; Iceland and White Sea.
  • Kabata, Z.. 2003. Copepods Parasitic on Fishes. 2nd, revised edition. Synopses of the British Fauna No. 47, 2nd, revised edition. Backhuys No. 47:1-274, 288 figs. ISBN 1-85153-265-X.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepeophtheirus pectoralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATAAGGATTATTATTCGATTAGAATTATCTCAGCCAGGYATATACTTAGGGGATTCTCAGGCTTACAATGTGATTGTAACGGCTCATGCCTTTATTATGATTTTTTTTATRGTAATGCCTGTATTAATTGGAGGATTTGGTAATTGGTTAGTTCCTTTAATACTTGGGGCCCCYGATATGGCTTTTCCTCGCTTGAATAATATAAGATTTTGGTTTTTAATACCTTCATTGAGATTRCTGTTAATAAGAGCTTTAGTTGAGAGAGGGGCGGGAACTGGTTGAACAGTTTACCCCCCYCTTTCGTCAAGAGTTTTTCATTCTGGGGCTTCTGTGGATTTTGCAATTTTTTCTTTGCATTTAGCGGGAGTGTCTTCTTTGTTGGGTGCTGTTAATTTTATCAGGACTATCACTAATTTGCGGTGCTTAGGTCTTTTAGTTGGGCAGATGCCTATATTTCCTTGGTCGGTATTAATTACTGCCGTCTTACTATTACTATCTTTACCTGTTCTTGCTGGAGCAATCACTATG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lepeophtheirus pectoralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lepeophtheirus pectoralis

Lepeophtheirus pectoralis, is a species of copepod in the genus Lepeophtheirus. It is a parasite of flatfish, the most frequent hosts being the European flounder, Platichthys flesus, the plaice, Pleuronectes platessa and the dab, Limanda limanda.[1] It feeds on the mucus, skin and blood of the fish, with oviferous females being found in the pectoral and pelvic fins of the host, while immature individuals and males are found in the rest of the body.[2]

Life Cycle[edit]

Its life cycle consists of 5 phases and 10 stages. The first two stages are free swimming nauplius I and II, while the third stage is the copepodid stage, during which attaches itself to the fish. Stages IV, V, VI and VII are the chalimus stages, and are followed by the pre-adult and adult stages, when differentiation of males and females is possible.[3]

See also[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!