Overview

Brief Summary

North American Ecology (US and Canada)

Siproeta stelenes is resident to the most southern tip of Texas and the southern tip of Florida, and ranges south to Brazil and the Greater Antilles and it migrates north as far as Kansas and central Florida (Scott 1986). Habitats are subtropical wooded areas. Host plants are semi-woody herbs, with known hosts restricted to two families, Acanthaceae and Plantaginaceae. Eggs are laid on the host plant singly or in a loose cluster of two or three eggs. There are multiple flights all year (Scott 1986).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Colonist in Texas (periodically) and S. Florida (established recently). Occasionally strays further north. Extends south through Central America and Antilles to Brazil. Only ssp. biplagiata occurs in our area.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Riparian and weedy areas, orchards;in USA with its larval host, Blechum browni.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on flower nectar, rotting fruit, mud, dung and moist leaf litter. Males perch and sometimes patrol for females (Scott, 1986).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Siproeta stelenes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCATTAAGTTTAATAATTCGACCAGAATTAGGAAACCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATCGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTTCTCCCCCCATCATTAATCTTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAACATTGCTCATGGAGGAACTTCTGTAGATTTAGCAATTTTCTCCCTTCATCTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACTATTATTAACATACGAATTAATAGAATATCTTTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGAATTACTGCCTTACTTCTCCTTCTTTCTCTTCTGGTTTTAGCAGGTGCTATTACAATACTTCTTACTGATCGAAATATTAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTNNATTTGATTTTTTGGTCATCCAGAAGTATATATTTTAATTCTTCCTGGATTTGGAATAATTTCTCATATTATTTCCCAAGAAAGAGGAAAAAAGGAAACTTTTGGATGTCTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACCGTTGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Siproeta stelenes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Colonies only in US; widespread elsewhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Siproeta stelenes

Siproeta stelenes meridionalis - MHNT

The Malachite (Siproeta stelenes) is a neotropical brush-footed butterfly (family Nymphalidae). The malachite has large wings that are black and brilliant green or yellow-green on the upperside and light brown and olive green on the underside. It is named for the mineral malachite, which is similar in color to the bright green on the butterfly's wings. Typically, the wingspread is between 8.5 and 10 cm (3.3 and 3.9 in). The malachite is found throughout Central and northern South America, where it is one of the most common butterfly species. Its distribution extends as far north as southern Texas and the tip of Florida, to Cuba as subspecies S. s. insularis (Holland, 1916), and south to Brazil.

Adults feed on flower nectar, rotting fruit, dead animals, and bat dung. Females lay eggs on the new leaves of plants in the Acanthaceae family, especially ruellia. The larvae are horned, spiny, black caterpillars with red markings.

Malachites often are confused with Philaethria dido. They have similar coloration, but their wing shapes are different.[1]

References[edit]

  1. ^ "Malachite". Butterflies of the Amazon and Andes. Retrieved July 30, 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!