Overview

Distribution

depth in m: 50-1500; horizontal distribution: North and South Pacific; absent in the equatorial part; not found in the northern hemispere (south of 17°N); tropical and subtropical parts of the Indian and Atlantic Oceans
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Epipelagic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 201 specimens in 1 taxon.
Water temperature and chemistry ranges based on 198 samples.

Environmental ranges
  Depth range (m): 50 - 5357.5
  Temperature range (°C): 2.520 - 21.473
  Nitrate (umol/L): 0.235 - 42.002
  Salinity (PPS): 34.406 - 36.464
  Oxygen (ml/l): 1.874 - 5.846
  Phosphate (umol/l): 0.143 - 2.980
  Silicate (umol/l): 1.383 - 69.094

Graphical representation

Depth range (m): 50 - 5357.5

Temperature range (°C): 2.520 - 21.473

Nitrate (umol/L): 0.235 - 42.002

Salinity (PPS): 34.406 - 36.464

Oxygen (ml/l): 1.874 - 5.846

Phosphate (umol/l): 0.143 - 2.980

Silicate (umol/l): 1.383 - 69.094
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Accession numbers:
AY601097
AF296708
AF296701
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Census of Marine Zooplankton

Source: Census of Marine Zooplankton

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Thysanopoda obtusifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATATTTTATTTTTGGTGCATGAGCTGGTATAGTAGGTACTTCACTAAGACTTATCATTCGAGCTGAATTAGGTCATCCAGGAAGATTAATTGGAGAT---GATCAAATCTATAATGTAGTAGTAACAGCTCATGCATTTGTCATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATGGCATTCCCTCGGATAAACAATATAAGATTTTGATTACTACCCCCTTCATTAACATTATTATTAGGGAGAGGTTTAGTAGAAAGAGGAGTGGGAACAGGATGAACTGTATACCCTCCTTTATCAGCTAGAATTGCACATGCAGGAGCTTCAGTTGATATAGGAATTTTTTCTTTACATATTGCAGGAGCTTCTTCTATTTTAGGAGCTGTAAATTTCATTACAACTGTAATTAACATACGATCTTCAGGAATAACTATAGACCGAATTCCATTATTTGTATGGTCTGTATTTATTACAGCTATTTTACTTCTTTTATCACTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTTTCGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thysanopoda obtusifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!