Overview

Brief Summary

Living Material

The sexes are separate and are easily recognized during the breeding season. The ripe gonads are very extensive and surround the visceral mass just above the foot; in mature females, they are chocolate brown in color, in males they are yellow.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Living Material

This bivalve may be found burrowing in sandy mud or swimming in shallow coves and inlets. At Woods Hole, Mass., it is easily obtained by dredging in Eel Pond or Hadley Harbor; the pollution of Eel Pond, however, is not conducive to the development of prime individuals.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Living Material

The sexes are separate and are easily recognized during the breeding season. The ripe gonads are very extensive and surround the visceral mass just above the foot; in mature females, they are chocolate brown in color, in males they are yellow.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Living Material

This bivalve may be found burrowing in sandy mud or swimming in shallow coves and inlets. At Woods Hole, Mass., it is easily obtained by dredging in Eel Pond or Hadley Harbor; the pollution of Eel Pond, however, is not conducive to the development of prime individuals.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Gulf of St. Lawrence (unspecified region), northern Gaspe waters, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel), Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), lower St. Lawrence estuary, middle North Shore (from Sept- Iles to Cape Whittle, including the Mingan Islands); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; North Carolina
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 638 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): -99 - 260
  Temperature range (°C): 6.405 - 16.407
  Nitrate (umol/L): 1.399 - 16.387
  Salinity (PPS): 32.546 - 35.060
  Oxygen (ml/l): 4.520 - 6.535
  Phosphate (umol/l): 0.390 - 1.251
  Silicate (umol/l): 1.668 - 15.041

Graphical representation

Depth range (m): -99 - 260

Temperature range (°C): 6.405 - 16.407

Nitrate (umol/L): 1.399 - 16.387

Salinity (PPS): 32.546 - 35.060

Oxygen (ml/l): 4.520 - 6.535

Phosphate (umol/l): 0.390 - 1.251

Silicate (umol/l): 1.668 - 15.041
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

infralittoral and circalittoral of the Gulf and estuary
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 638 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): -99 - 260
  Temperature range (°C): 6.405 - 16.407
  Nitrate (umol/L): 1.399 - 16.387
  Salinity (PPS): 32.546 - 35.060
  Oxygen (ml/l): 4.520 - 6.535
  Phosphate (umol/l): 0.390 - 1.251
  Silicate (umol/l): 1.668 - 15.041

Graphical representation

Depth range (m): -99 - 260

Temperature range (°C): 6.405 - 16.407

Nitrate (umol/L): 1.399 - 16.387

Salinity (PPS): 32.546 - 35.060

Oxygen (ml/l): 4.520 - 6.535

Phosphate (umol/l): 0.390 - 1.251

Silicate (umol/l): 1.668 - 15.041
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Later Stages of Development and Metamorphosis

The early barrel-shaped larva is marked by a unique structure: a ciliated outer covering which is discarded at metamorphosis. The ectodermal cells which form this covering, or test, are arranged in five distinct rows. The two end rows are covered with short, evenly distributed cilia, and each of the intervening rows bears a band of longer, powerful cilia. A very long apical tuft is visible at one pole, and at the opposite pole is the blastopore. Close to this, on one side, there is a small invagination, the stomodeum. Beneath the test, another ectodermal layer is formed, that of the embryo proper.

At metamorphosis, the animals settle to the bottom, the apical cilia shrivel, and the test cells disintegrate. The young animal which emerges has a pair of straight hinged shell valves, otocysts containing otoliths, and a well-developed foot which becomes active within a few hours. There are rudimentary gills and a complex rudimentary digestive tract. Further details, and illustrations of the development of this animal, may be found in the papers by Drew (1897, 1899a, 1899b).).

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Later Stages of Development and Metamorphosis

The early barrel-shaped larva is marked by a unique structure: a ciliated outer covering which is discarded at metamorphosis. The ectodermal cells which form this covering, or test, are arranged in five distinct rows. The two end rows are covered with short, evenly distributed cilia, and each of the intervening rows bears a band of longer, powerful cilia. A very long apical tuft is visible at one pole, and at the opposite pole is the blastopore. Close to this, on one side, there is a small invagination, the stomodeum. Beneath the test, another ectodermal layer is formed, that of the embryo proper.

At metamorphosis, the animals settle to the bottom, the apical cilia shrivel, and the test cells disintegrate. The young animal which emerges has a pair of straight hinged shell valves, otocysts containing otoliths, and a well-developed foot which becomes active within a few hours. There are rudimentary gills and a complex rudimentary digestive tract. Further details, and illustrations of the development of this animal, may be found in the papers by Drew (1897, 1899a, 1899b).).

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Cleavage

Cleavage is total, unequal and spiral. Gastrulation is by epiboly.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Unfertilized Ovum

The mature egg measures approximately 150 microns in diameter, and is free of membranes (Drew, 1897). It is chocolate brown in color and very opaque, containing a large amount of yolk. Two polar bodies are extruded and lost shortly after the ovum is shed.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Season

Probably during the early summer months. However, the season has not been determined for the Woods Hole area.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cleavage

Cleavage is total, unequal and spiral. Gastrulation is by epiboly.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

The Unfertilized Ovum

The mature egg measures approximately 150 microns in diameter, and is free of membranes (Drew, 1897). It is chocolate brown in color and very opaque, containing a large amount of yolk. Two polar bodies are extruded and lost shortly after the ovum is shed.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Season

Probably during the early summer months. However, the season has not been determined for the Woods Hole area.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Rate of Development

Development is fairly rapid. The first cleavage occurs about two hours after insemination. By 36 hours, the swimming embryo has a developing shell gland and cerebral ganglion, and by 80 to 105 hours it metamorphoses.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rate of Development

Development is fairly rapid. The first cleavage occurs about two hours after insemination. By 36 hours, the swimming embryo has a developing shell gland and cerebral ganglion, and by 80 to 105 hours it metamorphoses.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Yoldia limatula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TACTTTATTATTGGATTATGAGCAGGAATAATAGGAACCACTTTAAGGTTGATAATCCGTTTGAATTTACGGGTTCCTGGAAGAAAGTTATTCGAT---CCGCATATATATAATGTGATTGTTACGGCACACGCATTAATTATGATTTTTTTTATGGTTATGCCCGTAATATTAGGGGGTTTTGGAAATTGACTCGTCCCTTTAATATTAGGTGTGCCTGATATGTGTTATGCACGTCTAAACAATTTAAGGTTTTGGTTGGTTCCTTATGCTTTATTATGTTTATTAATATCAGTGATGTTTGATAAAGGGGCAGGAACAGGTTGAACTATGTACCCTCCTCTTTCTAGCTATAACTATCATACGGGGACCAGGGTTGATCTGGCATGTGTTTCATTACACTTGTCAGGTTTATCCTCTTTATTGGGGTCTATAAATTTTATGGCCACTATTGTGATAATGCGACCAAAGGAAGAAACTTGAGATAAAATTGCTTTATTGCCATGTGCTATTTGTGTCACGAGATTTTTGTTACTGATCTCTTTGCCTGTATTGGGGGGGGGTGTGACAATACTGATCGCAGATCGGCATTTTAATACAACTTTTTTTATCCCTAAAGGTGGTGGGGACCCGGTGTTATTTCAGCATTTATTTTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Yoldia limatula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Preparation of Cultures

Naturally-inseminated eggs may be reared through metamorphosis. No special feeding is necessary, as the larvae are well supplied with yolk. They are free-swimming and should be decanted daily to fresh sea water.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procuring Gametes

It is not known whether eggs removed from the gonads can be artificially inseminated. Mature animals, however, will spawn spontaneously in the laboratory.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

Adults may be kept in aquaria or in large fingerbowls supplied with running sea water.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Biodiversity Literature Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preparation of Cultures

Naturally-inseminated eggs may be reared through metamorphosis. No special feeding is necessary, as the larvae are well supplied with yolk. They are free-swimming and should be decanted daily to fresh sea water.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Procuring Gametes

It is not known whether eggs removed from the gonads can be artificially inseminated. Mature animals, however, will spawn spontaneously in the laboratory.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

Adults may be kept in aquaria or in large fingerbowls supplied with running sea water.

  • Drew, G. A., 1897. Notes on the embryology, anatomy, and habits of Yoldia limatula, Say. Johns Hopkins Univ. Circ., 17: 11-14.
  • Drew, G. A., 1899a. The anatomy, habits, and embryology of Yoldia limatula, Say. Mem. Biol. Lab., Johns Hopkins Univ., 4: no. 3, 1-37.
  • Drew, G. A., 1899b. Some observations on the habits, anatomy and embryology of members of the Protobranchia. Anat. Anz., 15: 493-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yoldia limatula

Yoldia limatula illustration.png

Yoldia limatula, commonly called the file yoldia, is a clam in the family Yoldiidae. It can be found along the Atlantic coast of North America, from the Gulf of St. Lawrence to New Jersey, as well as along the Pacific coast, from Alaska to San Diego.[1]

References[edit]

  1. ^ Abbott, R.T. & Morris, P.A. A Field Guide to Shells: Altantic and Gulf Coasts and the West Indies. New York: Houghton Mifflin, 1995. 6.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!