Overview

Comprehensive Description

General Description

Diagnosis: A modioliform shell with slightly recurved ventral margins. The periostracum is polished with fine concentric lirae. The ligament is weak, opisthodetic and external. The hinge line has minute vertical striations.

Description: The shell is thin, elongated and modioliform. The anterior and posterior margins are rounded, with the ventral margin slightly incurved. The surface is ornamented by fine concentric lirae and occasional growth-check marks. There are two obscure radial riblets present on the anterior third of the shell. The periostracum is thin, adherent and light yelow to brown in colour with an iridescent sheen. The umbones are prominent with prosogyrous beaks. The ligament is opisthodetic, sunk in a shallow channel. The interior is polished and subnacreous. The hinge margins are slightly thickened with numerous fine vertical striations. The adductor muscle scars are subequal and indistinct. The pallial line is not visible, and there is no pallial sinus.

Anatomy: The mantle is fused only by an inner fold to form a small separate exhalant aperture. The mantle margins are muscularised and strongly attached to the periostracum which forms a band on the inner shell margins. There are no tentacles or papillae present and the marginal folds are reduced, except in the region of the inhalant aperture where an extensible hood is present. The foot is small, laterally compressed with a small planar sole. A deep byssal groove is present. The pedal retractor and extensor muscles are well developed. The gills are rather small and thick. The labial palps are small and narrow. The lips are small and simple. The stomach is small; the crystalline-style pouch and midgut are conjoined. The intestine passes over the adductor muscle and terminates in an extensible rectum.

(Bernard, 1978)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1519.5 - 2415
  Temperature range (°C): 1.744 - 2.777
  Nitrate (umol/L): 34.711 - 41.842
  Salinity (PPS): 34.493 - 34.634
  Oxygen (ml/l): 1.490 - 3.998
  Phosphate (umol/l): 2.419 - 3.037
  Silicate (umol/l): 68.288 - 176.733

Graphical representation

Depth range (m): 1519.5 - 2415

Temperature range (°C): 1.744 - 2.777

Nitrate (umol/L): 34.711 - 41.842

Salinity (PPS): 34.493 - 34.634

Oxygen (ml/l): 1.490 - 3.998

Phosphate (umol/l): 2.419 - 3.037

Silicate (umol/l): 68.288 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

I. washingtonia demonstrates strong evidence of protandric hermaphroditism. Developing males were recognised in individuals as small as 1.7 mm shell length and spermatogenesis continued until not, vert, similar7 mm length. At >6.5 mm, males were generally spent and the first previtellogenic oocytes were observed. Although developing females were found as small as 4.5 mm shell length, most well-developed females were >6 mm shell length. Overall, females only formed not, vert, similar12% of the population. As with other modiolid bivalves, fecundity was high and the egg size <50 μm, indicative of planktotrophic development. The occurrence of protandric hermaphroditism, high fecundity and planktotrophic dispersal may be an adaptation to the ephemeral nature of their habitat (Tyler et al., 2009).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Idas washingtonia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTGGCTCGCCCCGGGAGGTTCCTGGGAGAT---GACCAGCTTTACAATGTTATTGTTACTGCTCATGCTCTAGTTATAATTTTTTTTATGGTGATGCCGCTAATAGTGGGCGGGTTTGGAAACTGGCTACTTCCTTTAATAATAGGGTCAATTGACATAATTTTCCCTCGTTTAAATAATTTGAGTTTTTGGTTTTTACCTGCCTCGCTTTTCACTTTGTTATTGTCAACCTTTATTGAAAGAGGCTCGGGCACGGGGTGGACGTTGTACCCTCCCTTATCTTCTTACACTGGCCACAGAGGTCCAGCAGTAGATATGTCTCTATTTTCTTTACACTTGGCCGGTGCTTCTTCTATTGGTGGGTCAATTAATTTCTTAACTAGAATGAAAAATATATCTGTTGAGAGGATGCGTGGGGAGCGGATGGTCTTATTTGTCTGATCTATGGCTGTAACAGCAGTGTTACTATTAGTGTCTTTGCCAGTGTTGGCAGGGGGTATCACTATGTTAATTTTTGATCGTCATTTTAACACT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Idas washingtonia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!