Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 50 - 88

Graphical representation

Depth range (m): 50 - 88
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 44 specimens in 6 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 45 - 145
  Temperature range (°C): 19.588 - 23.314
  Nitrate (umol/L): 7.646 - 11.879
  Salinity (PPS): 34.585 - 35.409
  Oxygen (ml/l): 2.594 - 3.991
  Phosphate (umol/l): 0.277 - 0.852
  Silicate (umol/l): 4.033 - 15.169

Graphical representation

Depth range (m): 45 - 145

Temperature range (°C): 19.588 - 23.314

Nitrate (umol/L): 7.646 - 11.879

Salinity (PPS): 34.585 - 35.409

Oxygen (ml/l): 2.594 - 3.991

Phosphate (umol/l): 0.277 - 0.852

Silicate (umol/l): 4.033 - 15.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 44 specimens in 6 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 45 - 145
  Temperature range (°C): 19.588 - 23.314
  Nitrate (umol/L): 7.646 - 11.879
  Salinity (PPS): 34.585 - 35.409
  Oxygen (ml/l): 2.594 - 3.991
  Phosphate (umol/l): 0.277 - 0.852
  Silicate (umol/l): 4.033 - 15.169

Graphical representation

Depth range (m): 45 - 145

Temperature range (°C): 19.588 - 23.314

Nitrate (umol/L): 7.646 - 11.879

Salinity (PPS): 34.585 - 35.409

Oxygen (ml/l): 2.594 - 3.991

Phosphate (umol/l): 0.277 - 0.852

Silicate (umol/l): 4.033 - 15.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:1
Specimens with Sequences:1
Specimens with Barcodes:1
Species:1
Species With Barcodes:1
Public Records:1
Public Species:1
Public BINs:1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Etrema sp. NP

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACGCTATATATTTTGTTTGGTATGTGGTCAGGGTTAGTTGGAACTGCTTTGAGTTTACTTATTCGGGCTGAATTAGGTCAGCCCGGAGCTCTTTTAGGAGACGATCAATTATATAATGTTATTGTAACGGCTCATGCTTTTGTTATAATTTTCTTCTTGGTGATGCCTATAATGATTGGTGGGTTTGGTAACTGGTTAGTTCCTTTGATACTAGGGGCTCCTGATATAGTTTTCCCCCGCCTAAACAATATGAGTTTTTGATTACTTCCACCTGCTTTGTTATTGTTACTATCTTCTGCTGCGGTAGAAAGAGGAGTGGGAACAGGTTGAACTGTTTATCCTCCTTTGTCGGGGAACTTGGCTCACGCCGGTGGTTCAGTTGACCTTGCTATTTTTTCTTTACATTTAGCTGGTGTTTCTTCTATTCTAGGTGCTGTAAACTTTATTACTACAATTATTAATATACGCTGACAAGGTATACAGTTCGAACGTCTACCTTTATTTGTGTGGTCAGTAAAGATTACAGCGATTCTTCTTCTTTTATCACTTCCTGTTTTAGCTGGGGCTATTACTATACTTTTAACTGATCGGAATTTTAACACTGCATTTTTTGACCCAGCTGGGGGTGGTGATCCTATTTTGTATCAGCATTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Etrema sp. NP

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Etrema

Etrema is a genus of sea snails, marine gastropod mollusks in the family Clathurellidae.[2]

Species[edit]

According to the World Register of Marine Species (WoRMS), species with valid names within the genus Etrema include: [3]

The Indo-Pacific Molluscan Database also includes the following species with names in current use : [6]

Subgenus Etrema Hedley, 1918
Subgenus Etremopa Oyama, 1953
Subgenus Etremopsis Powell, 1942
Species brought into synonymy

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!