Sthenoteuthis oualaniensis (Lesson, 1830 in 1830-1831)

Flying squid


Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: NOT EVALUATED external link Showing: scientific names

Media Center Navigation








Classification:

Table of Contents


Barcode

Locations of barcode samples

Source and Additional Information
Indexed
April 08, 2010

Collection Sites: world map showing specimen collection locations for Sthenoteuthis oualaniensis

Statistics of barcoding coverage

Source and Additional Information
Indexed
April 08, 2010

Barcode of Life Data Systems (BOLD) Stats
                                                           
Specimen Records:39
Specimens with Sequences :39
Specimens with Barcodes :39
Public Records :39
Species :1
Species With Barcodes :1

Barcode data

Source and Additional Information
Indexed
April 08, 2010

  The following is a representative barcode sequence, the centroid of all available sequences for this species.   


There are 39 barcode sequences available from BOLD and GenBank.    Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.    See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GBCPH760-08|EU660576|Sthenoteuthis oualaniensis| ATGCGATGACTATTTTCTACAAACCATAAAGACATTGGTACTCTATACTTTATTTTTGGTATTTGGGCAGGACTTCTAGGGACCTCCCTA---AGATTAATAATCCGTACCGAACTAGGTCAACCCGGGTCGTTACTAAACGAT---GATCAACTATATAATGTCGTAGTTACTGCACATGGTTTCATTATAATCTTTTTTCTAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATA---TTGGGAGCTCCGGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTCCTTCCTCCTTCCCTAACTTTATTATTAGCTTCTTCTGCTGTAGAAAGAGGAGCAGGAACAGGTTGAACAGTTTACCCTCCTTTATCTAGTAATTTATCCCATGCTGGACCATCAGTTGACTTA---GCTATTTTCTCTCTACATCTTGCTGGTATCTCTTCTATTCTAGGAGCAATTAATTTTATTACTACCATCCTGAATATACGATGAGAAGGACTTCAAATGGAGCGACTACCTTTGTTTGCCTGATCTGTTTTTATTACTGCTATTCTTTTACTTTTATCCTTACCTGTTTTAGCAGGA---GCAATTACTATACTACTAACCGACCGAAATTTTAATACTACATTTTTTGATCCAAGAGGAGGGGGAGACCCTATCTTATATCAACACTTGTTTTGATTCTTCGGTCACCCAGAAGTTTATATTTTAATTTTACCTGCTTTTGGTATTATTTCACATATTGTATCCCATCATTCTTTCAAAAAA---GAAATCTTTGGGGCTTTAGGTATAATTTATGCAATGTTATCTATTGGTCTTCTAGGTTTCATTGTATGAGCTCATCACATGTTCACTGTAGGTATGG 
-- end --

Download FASTA File
"Sthenoteuthis oualaniensis (Lesson, 1830 in 1830-1831)". Encyclopedia of Life, available from "http://www.eol.org/pages/492079". Accessed 30 Jul 2010.