Sthenoteuthis oualaniensis (Lesson, 1830 in 1830-1831)
Flying squid
Species recognized by The Integrated Taxonomic Information System
, T Orrell (custodian) in
Table of Contents
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
- Add New Content
Barcode
Statistics of barcoding coverage
Source and Additional Information
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 39 |
| Specimens with Sequences : | 39 |
| Specimens with Barcodes : | 39 |
| Public Records : | 39 |
| Species : | 1 |
| Species With Barcodes : | 1 |
Barcode data
Source and Additional Information
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 39 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 39 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBCPH760-08|EU660576|Sthenoteuthis oualaniensis| ATGCGATGACTATTTTCTACAAACCATAAAGACATTGGTACTCTATACTTTATTTTTGGTATTTGGGCAGGACTTCTAGGGACCTCCCTA---AGATTAATAATCCGTACCGAACTAGGTCAACCCGGGTCGTTACTAAACGAT---GATCAACTATATAATGTCGTAGTTACTGCACATGGTTTCATTATAATCTTTTTTCTAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATA---TTGGGAGCTCCGGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTCCTTCCTCCTTCCCTAACTTTATTATTAGCTTCTTCTGCTGTAGAAAGAGGAGCAGGAACAGGTTGAACAGTTTACCCTCCTTTATCTAGTAATTTATCCCATGCTGGACCATCAGTTGACTTA---GCTATTTTCTCTCTACATCTTGCTGGTATCTCTTCTATTCTAGGAGCAATTAATTTTATTACTACCATCCTGAATATACGATGAGAAGGACTTCAAATGGAGCGACTACCTTTGTTTGCCTGATCTGTTTTTATTACTGCTATTCTTTTACTTTTATCCTTACCTGTTTTAGCAGGA---GCAATTACTATACTACTAACCGACCGAAATTTTAATACTACATTTTTTGATCCAAGAGGAGGGGGAGACCCTATCTTATATCAACACTTGTTTTGATTCTTCGGTCACCCAGAAGTTTATATTTTAATTTTACCTGCTTTTGGTATTATTTCACATATTGTATCCCATCATTCTTTCAAAAAA---GAAATCTTTGGGGCTTTAGGTATAATTTATGCAATGTTATCTATTGGTCTTCTAGGTTTCATTGTATGAGCTCATCACATGTTCACTGTAGGTATGG
-- end --
-- end --
Download FASTA File
"Sthenoteuthis oualaniensis (Lesson, 1830 in 1830-1831)". Encyclopedia of Life, available from "http://www.eol.org/pages/492079". Accessed
30 Jul 2010.


Retrieving comments, please wait...



Retrieving comments, please wait...
Loading curation controls, please wait...




Loading curation controls, please wait...






