Overview

Distribution

depth in m: 100-300; horizontal distribution: subtropical in all basins
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Epipelagic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 223 specimens in 1 taxon.
Water temperature and chemistry ranges based on 222 samples.

Environmental ranges
  Depth range (m): 5 - 5422.5
  Temperature range (°C): 2.451 - 21.473
  Nitrate (umol/L): 0.040 - 39.883
  Salinity (PPS): 34.057 - 36.952
  Oxygen (ml/l): 1.351 - 5.846
  Phosphate (umol/l): 0.052 - 2.822
  Silicate (umol/l): 0.844 - 77.234

Graphical representation

Depth range (m): 5 - 5422.5

Temperature range (°C): 2.451 - 21.473

Nitrate (umol/L): 0.040 - 39.883

Salinity (PPS): 34.057 - 36.952

Oxygen (ml/l): 1.351 - 5.846

Phosphate (umol/l): 0.052 - 2.822

Silicate (umol/l): 0.844 - 77.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphausia brevis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATACTTTATTTTCGGAGCTTGAGCTGGGATAGTAGGTACCTCTTTAAGTTTAATTATTCGAGCTGAATTAGGACACCCTGGGAGATTAATTGGAGAT---GATCAAATTTATAACGTGGTAGTAACAGCACATGCCTTTGTTATAATTTTCTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTCTTATACTAGGAGCCCCAGATATGGCCTTCCCACGAATAAACAATATAAGATTTTGGTTACTACCACCTTCATTAACTTTATTGCTTGGAAGAGGCCTAGTTGAAAGTGGAGTTGGTACAGGATGAACTGTCTATCCTCCACTATCTGCAGGAATTGCACATGCTGGTGCATCAGTAGATATAGGAATTTTTTCACTTCATATTGCAGGGGCTTCCTCTATTTTAGGAGCCGTAAACTTTATTACAACTGTTATTAATATACGATCTGCAGGTATAACTATAGACCGTATTCCACTATTTGTTTGATCAGTATTTATTACAGCAATTCTTTTACTTTTATCTCTACCAGTGTTAGCTGGAGCTATTACAATACTTTTAACTGATCGTAATTTGAATACTTCTTTCTTTGACCCAGCTGGTGGTGGAGACCCAATTTTATATCAACACTTATTTTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Euphausia brevis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!