Overview

Distribution

depth in m: 0-600; horizontal distribution: sub-Antarctic,sub-tropical, bipolar; boreal and antiboreal zones
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

south of 50 degrees North
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Mesopelagic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epipelagic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

pelagic species, found from surface to 1000 m
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 61 specimens in 1 taxon.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): 5 - 1375
  Temperature range (°C): 4.560 - 21.351
  Nitrate (umol/L): 0.052 - 33.273
  Salinity (PPS): 34.418 - 36.936
  Oxygen (ml/l): 1.958 - 5.630
  Phosphate (umol/l): 0.055 - 2.111
  Silicate (umol/l): 0.943 - 41.912

Graphical representation

Depth range (m): 5 - 1375

Temperature range (°C): 4.560 - 21.351

Nitrate (umol/L): 0.052 - 33.273

Salinity (PPS): 34.418 - 36.936

Oxygen (ml/l): 1.958 - 5.630

Phosphate (umol/l): 0.055 - 2.111

Silicate (umol/l): 0.943 - 41.912
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thysanoessa gregaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATACTTCATTTTTGGTGCATGAGCTGGAATAGTAGGCACTTCTTTAAGATTAATTATTCGAGCTGAACTAGGTCAACCTGGGAGATTAATTGGAGAT---GATCAAATTTATAATGTTGTTGTTACAGCACATGCTTTTGTTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCCCTTATGCTTGGTGCACCTGATATAGCTTTTCCACGTATGAATAATATAAGGTTTTGACTTCTGCCACCTTCCTTAACTCTTTTACTAGGTAGAGGCCTTGTAGAGAGAGGAGTTGGCACAGGTTGAACTGTTTATCCTCCTTTATCTGCAGGCATCGCCCATGCTGGAGCTTCAGTGGATATAGGAATCTTTTCATTACATATTGCAGGAGCTTCATCTATTTTAGGTGCAGTAAATTTTATTACTACTGTAATTAATATACGATCTGCTGGAATAACTATAGACCGAATACCTTTATTTGTATGATCTGTATTTATTACAGCAATTTTACTTCTACTATCTTTACCAGTTTTAGCTGGGGCTATCACTATACTTTTAACAGACCGTAATCTGAATACTTCTTTTTTTGACCCAGCAGGAGGAGGAGACCCTATTTTATACCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thysanoessa gregaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!