Overview

Comprehensive Description

Biology

Found in coastal and oceanic waters (Ref. 5578). Feeds on plankton (Ref. 30573). Ovoviviparous (Ref. 50449). Generally found in schools, leaping out of the water (Ref. 11228). Caught rarely in the tuna gillnet fisheries. Utilized for its gill filter plates (high value), meat, cartilage and skin (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: eastern coast of Africa to Indonesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

120 cm WD (female); max. published weight: 30.0 kg (Ref. 11228)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A small devilray with a short head bearing short head fins; dorsal fin white-tipped, and pectoral fins with slightly curved tips; upper surface with no denticles and tail shorter than disc, with no spine (Ref. 5578). Dark brown above, white below (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in coastal and oceanic waters. Feeds on plankton.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Probably giving birth to only one pup; born at ~31 cm WD (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mobula kuhlii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACTTAATCTTTGGTGCATGAGCAGGGATAGTGGGCACTGGTCTTAGCCTACTAATTCGAACGGAATTAAGCCAACCAGGGGCCTTACTAGGTGACGACCAAATTTACAATGTGGTAGTTACTGCCCATGCTTTCGTAATAATCTTCTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGACTAGTTCCTTTAATAATTGGTGCTCCAGACATGGCCTTCCCTCGAATAAATAACATAAGTTTTTGACTCCTTCCTCCATCCTTCCTCTTACTACTAGCTTCAGCAGGAGTAGAAGCTGGGGCCGGGACTGGGTGAACTGTCTATCCTCCTCTGGCCGGTAATCTAGCACATGCTGGAGCCTCTGTAGATCTTACTATCTTTTCCCTGCACTTAGCCGGGGTCTCCTCCATTTTAGCATCAATCAATTTTATTACTACAATTATCAACATGAAACCACCTGCAATTTCTCAGTATCAAACACCCTTGTTTGTCTGATCTATTCTAATTACAACTGTTCTCCTCTTATTATCCCTTCCCGTCCTAGCAGCAGGCATTACTATGCTTCTCACAGATCGTAATCTTAATACAACCTTCTTTGATCCGGCAGGGGGTGGAGATCCTATTCTCTACCAACATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mobula kuhlii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mobula kuhlii

Mobula kuhlii, the shortfin devil ray, is a species of eagle ray in the genus Mobula. It is endemic to the Indian Ocean and central-west Pacific Ocean. It ranges from South Africa, Tanzania and the Seychelles in the west to the Philippines and Indonesia in the east, and southward to the northern coast of Australia.

Description[edit]

The shortfin devil ray is a small eagle ray growing to a maximum width of 120 cm (47 in) and a weight of 30 kilograms (66 lb). It is flattened horizontally with a wide central disc and the head is short with small cephalic fins. The large pectoral fins have curved tips and the dorsal fin has a white tip. The tail is not tipped with a spine and is shorter than the body. The dorsal surface of this fish is brown and does not bear any placoid scales, and the ventral surface is white.[3][4]

Biology[edit]

The shortfin devil ray feeds on plankton and possibly also on small fish and squid. It gathers its food by swimming with its mouth open and passing the water over its gill rakers which filter out the food particles. It is an ovoviviparous fish and has the lowest rate of reproduction of any of the elasmobranchs.[1] A litter usually consists of a single pup and the gestation period is one to three years.[1]

Status[edit]

The International Union for Conservation of Nature have classified the conservation status of this species as "data deficient". This is because the shortfin devil ray is the subject of both targeted and bycatch inshore fisheries, but insufficient records are kept to enable population trends to be estimated. However, it is vulnerable to over-fishing because of its low reproductive rate. Targeted fisheries occur in India, Sri Lanka and Thailand, and this ray is caught in Indonesia especially for its gill rakers.[1] These are valuable because of their use in traditional Chinese medicine. The flesh is used for human consumption, the skin is dried and deep fried, and the cartilage is used as a filler in the manufacture of shark fin soup.[5]

References[edit]

  1. ^ a b c d Bizzarro, J.; Smith, W.; White, W.T.; Valenti, S.V. (2009). "Mobula kuhlii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 2015-01-14. 
  2. ^ a b Bailly, Nicolas (2014). "Mobula kuhlii (Müller & Henle, 1841)". World Register of Marine Species. Retrieved 2015-01-14. 
  3. ^ "Mobula kuhlii (Müller & Henle, 1841)". FishBase. Retrieved 2015-01-09. 
  4. ^ Notarbartalo-di-Sciara, G, (1987). "A revisionary study of the genus Mobula Rafinesque, 1810 (Chondrichthyes: Mobulidae) with the description of a new species". Zoological Journal of the Linnean Society 91 (1): 1–91. doi:10.1111/j.1096-3642.1987.tb01723.x. 
  5. ^ White, William T.; Giles, Jenny; Dharmadi, Potter, Ian C. (2006). "Data on the bycatch fishery and reproductive biology of mobulid rays (Myliobatiformes) in Indonesia". Fisheries Research 82 (1–3): 65–73. doi:10.1016/j.fishres.2006.08.008. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!