Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Living Material

Both species are potentially protandric hermaphrodites. The active males are small, whereas the mature females are the large, older individuals; all sizes and sexual conditions can be found in any colony.

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Living Material

The greenish-brown, boat-shaped C. fornicata adults pile one on top of another to form "chains" of individuals; the colony is attached to a stone, shell or other solid object by the bottom limpet. This species can be collected at Vineyard Haven Harbor, Mass. Another species common to the Woods Hole area, C. plana, is found within whelk or moon snail shells inhabited by large hermit crabs, and can be obtained at Cotuit. This species has a flat, whitish shell and is considerably smaller than C. fornicata.

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

American slipper limpets look like slippers, therefore their name. They live off of plankton which they filter out of the seawater. They are often found piled one on top of another (up to twelve specimen), a real slipper limpet skyscraper. The snails at the top of the tower are always younger and male, the middle ones are in the process of changing sex and the lowest ones are older and female. American slipper limpets were imported during the previous century from North America, along with a load of oysters.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 The shell is oval, up to 5 cm in length, with a much reduced spire. The large aperture has a shelf, or septum, extending half its length. The shell is smooth with irregular growth lines and white, cream, yellow or pinkish in colour with streaks or blotches of red or brown. Slipper limpets are commonly found in curved chains of up to 12 animals. Large shells are found at the bottom of the chain, with the shells becoming progressively smaller towards the top.Crepidula fornicata is a non-native species. The modern British population is known to have been introduced to Essex between 1887 and 1890 in association with oysters, Crassostrea virginica, imported from North America (Fretter & Graham, 1981; Eno et al., 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

In the older fauna lists (e.g. De Malzine (1867), Colbeau (1868), Pelseneer (1881b), Maitland (1897) and Vonck (1933)) Crepidula fornicata is absent, contrary to nowadays. This species was introduced only in the thirties

For a discussion on the way of distribution and introduction see: Adam, W.; Leloup, E. (1934). Sur la présence du gastéropode Crepidula fornicata (Linné, 1758) sur la côte belge. [Occurrence of the gastropod Crepidula fornicata (Linné, 1758) at the Belgian coast.] Bull. Mus. royal d'Hist. Nat. Belg./Med. Kon. Natuurhist. Mus. Belg. 10(45): 1-6.

translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range: 48°N to 25°N; 97.2°W to 25°W. Distribution: Canada; Canada: Nova Scotia, Prince Edward Island, New Brunswick; USA: Maine, Massachusetts, Connecticut, New York, New Jersey, Virginia, North Carolina, Georgia, Florida; Florida: East Florida, West Florida; USA: Louisiana, Texas; introduced to the state of Washington.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the older fauna lists (e.g. De Malzine (1867), Colbeau (1868), Pelseneer (1881b), Maitland (1897) and Vonck (1933)) Crepidula fornicata is absent, contrary to nowadays. This species was introduced only in the thirties

For a discussion on the way of distribution and introduction see: Adam, W.; Leloup, E. (1934). Sur la présence du gastéropode Crepidula fornicata (Linné, 1758) sur la côte belge. [Occurrence of the gastropod Crepidula fornicata (Linné, 1758) at the Belgian coast.] Bull. Mus. royal d'Hist. Nat. Belg./Med. Kon. Natuurhist. Mus. Belg. 10(45): 1-6.

translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range: 48°N to 25°N; 97.2°W to 25°W. Distribution: Canada; Canada: Nova Scotia, Prince Edward Island, New Brunswick; USA: Maine, Massachusetts, Connecticut, New York, New Jersey, Virginia, North Carolina, Georgia, Florida; Florida: East Florida, West Florida; USA: Louisiana, Texas; introduced to the state of Washington.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

infralittoral and circalittoral of the Gulf and estuary
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

infralittoral and circalittoral of the Gulf and estuary
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1859 specimens in 1 taxon.
Water temperature and chemistry ranges based on 71 samples.

Environmental ranges
  Depth range (m): -1.5 - 142
  Temperature range (°C): 6.920 - 26.823
  Nitrate (umol/L): 0.325 - 12.432
  Salinity (PPS): 32.282 - 36.284
  Oxygen (ml/l): 4.350 - 6.764
  Phosphate (umol/l): 0.076 - 1.123
  Silicate (umol/l): 0.756 - 10.019

Graphical representation

Depth range (m): -1.5 - 142

Temperature range (°C): 6.920 - 26.823

Nitrate (umol/L): 0.325 - 12.432

Salinity (PPS): 32.282 - 36.284

Oxygen (ml/l): 4.350 - 6.764

Phosphate (umol/l): 0.076 - 1.123

Silicate (umol/l): 0.756 - 10.019
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Crepidula fornicata is typically found attached to shells and stones on soft substrata around the low water mark and the shallow sublittoral. It is often attached to the shells of mussels Mytilus edulis and oysters Ostrea edulis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

alien species

Het muiltje Crepidula fornicata kwam oorspronkelijk enkel voor langs de oostkust van Noord-Amerika. De soort is echter naar Europa overgebracht samen met Amerikaanse oesters Crassostrea virginica. Het eerste Belgische exemplaar werd gevonden op 28 september 1911 op een oester in Oostende en sinds de jaren ’30 is het een algemene soort langs onze kust. Het muiltje kent hier weinig tot geen predatoren en kan gedijen op verschillende types harde bodems en schelpenbanken. Een verdere uitbreiding naar meer noordelijke gebieden wordt wellicht verhinderd door de temperatuur: lage watertemperaturen tijdens de winter kunnen namelijk de ontwikkeling van het muiltje afremmen of verhinderen.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

Species introduced
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alien species

The common Atlantic slipper snail or slipper limpet Crepidula fornicata originates from the east coast of North-America. The species was however brought to Europe together with the eastern oyster Crassostrea virginica. In Belgium, the first slipper limpet was found on 28 September 1911 attached to an oyster in Ostend and since the 1930’s, it is seen as a common species along the Belgian coast. The slipper limpet has little to no predators here, and can thrive on several types of hard bottoms and shellfish banks. A continued expansion to the north is probably inhibited by temperature: low temperatures during the winter can slow down or inhibit the development of the slipper limpet.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

alien species

Het muiltje Crepidula fornicata kwam oorspronkelijk enkel voor langs de oostkust van Noord-Amerika. De soort is echter naar Europa overgebracht samen met Amerikaanse oesters Crassostrea virginica. Het eerste Belgische exemplaar werd gevonden op 28 september 1911 op een oester in Oostende en sinds de jaren ’30 is het een algemene soort langs onze kust. Het muiltje kent hier weinig tot geen predatoren en kan gedijen op verschillende types harde bodems en schelpenbanken. Een verdere uitbreiding naar meer noordelijke gebieden wordt wellicht verhinderd door de temperatuur: lage watertemperaturen tijdens de winter kunnen namelijk de ontwikkeling van het muiltje afremmen of verhinderen.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

Species introduced
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alien species

The common Atlantic slipper snail or slipper limpet Crepidula fornicata originates from the east coast of North-America. The species was however brought to Europe together with the eastern oyster Crassostrea virginica. In Belgium, the first slipper limpet was found on 28 September 1911 attached to an oyster in Ostend and since the 1930’s, it is seen as a common species along the Belgian coast. The slipper limpet has little to no predators here, and can thrive on several types of hard bottoms and shellfish banks. A continued expansion to the north is probably inhibited by temperature: low temperatures during the winter can slow down or inhibit the development of the slipper limpet.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Crepidula fornicata (Suspension-feeding molluscs) is prey of:
Nemertines
Nereidae
Hesionidae
Glyceridae
Onuphidae
Odostomia seminuda
Acanthocitona pygmaea
Hylina veliei
Spirals
Nudibranchia
Polinices
Terebra
Seila adamsi
Epitonium albidum
Opalia hotessieriana
Natica pusilla
Urosalpinx perrugata
Busycon spiratum
Marginella aureocincta
Marginella apicina
Marginella bella
Turbonilla dalli
Turbonilla hemphilli
Gobiosoma robustum
Microgobius gulosus
Anas discors
Bucephala albeaola
Rallus longirostris
Charadrius semipalmatus
sediment POC
Callinectes sapidus
Processa bermudiensis
Penaeus duoarum
Palaemonetes floridanus

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Crepidula fornicata (Suspension-feeding molluscs) preys on:
phytoplankton
bacterioplankton
Microprotozoa

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Later Stages of Development and Metamorphosis

There is no typical trochophore stage; the gastrula transforms directly into a veliger larva. The veliger has a bilobed, ciliated velum which develops purple pigment along its margin. The mouth and foot, containing a pair of statocysts, are on the ventral side. The head vesicle, the pair of pigmented eyes with lenses, the heart and oesophagus are dorsal. The digestive tract is well developed; stomach, liver and intestine can be seen. The anus lies on the right side, and the external kidneys are lateral to the foot. At metamorphosis, the head vesicle decreases rapidly in size, the velum is largely, if not entirely, absorbed, the foot becomes enlarged, and the shell, which during the veliger stage was of the spiral type, takes on the form characteristic of the adult. Consult the paper by Conklin (1897) for further details and illustrations of the larval stages of these species. A good description of organogenesis in C. adunca can be found in a paper by Moritz (1939).

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Cleavage

Two polar bodies are extruded and remain attached for some time. The pronuclei associate, but do not fuse, and the separate maternal and paternal portions of the zygote nucleus remain distinct at least until the 69-cell stage. Crepidula thus illustrates clearly the condition known as gonomery.

Cleavage is spiral and regular, and similar in all four quadrants as far as the 24-cell stage. Gastrulation is by epiboly, which is not accompanied by invagination. The mouth appears near the mid-ventral surface soon after the blastopore closes at this point (Conklin, 1897). Further details and illustrations of these early stages can be found in two papers by Conklin (1897, 1902).

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Ovum

The unsegmented ovum of both species is nearly spherical. It contains a small quantity of yolk granules which are more concentrated, and larger, at the vegetal pole. There is no egg membrane. The ovum of C. fornicata measures approximately 182 microns in diameter, that of C. plana about 136 microns. The eggs are deposited in transparent capsules (about 240 eggs per capsule for C. fornicata, and between 64 and 176 per capsule for C. plana), before maturation begins.

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Season

C. fornicata breeds from mid-June until mid-August. C. plana has a longer season; it breeds through the first week in September (Bumpus, 1898). Sexual activity is reduced to a minimum at sea water temperatures below 15 to 16° C. (Gould, 1950).

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Rate of Development

Development proceeds slowly. Not less than four hours elapse between fertilization and first cleavage. In both species, hatching of the fully-formed veliger takes about four weeks. The free-swimming period of C. fornicata probably lasts about two to three weeks (Conklin, 1897).

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crepidula fornicata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 31 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTATTTGGTATATGATCTGGACTAGTAGGAACAGCTCTAAGATTATTAATCCGAGCTGAACTTGGACAACCAGGTGCTCTCCTAGGCGAT---GATCAACTATACAATGTAATTGTTACAGCACACGCTTTTGTTATAATCTTTTTTCTAGTAATACCTATAATAATCGGGGGATTTGGTAATTGGTTAGTTCCATTAATGTTAGGTGCTCCTGATATAGCTTTTCCTCGACTTAATAACATAAGTTTCTGATTATTACCTCCAGCATTATTACTATTGCTATCCTCGGCCGCAGTAGAAAGAGGAGTTGGGACCGGTTGAACGGTTTATCCTCCTTTGTCTGGAAACCTAGCTCACGCTGGCGGGTCTGTTGATTTAGCAATTTTTTCTTTACATCTTGCTGGTGTTTCATCAATTTTAGGAGCTGTTAATTTTATTACTACTGTAATTAATATACGTTGACAAGGAGTTCAATTTGAACGACTTCCTTTATTTGTATGATCAGTTAAAATTACAGCCATTCTATTATTACTTTCTTTACCAGTGTTAGCCGGAGCAATTACGATGCTTTTATCAGATCGAAATTTTAATACCGCTTTCTTTGATCCTGCAGGAGGAGGTGATCCTATCTTATATCAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crepidula fornicata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 31
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Preparation of Slides

Sections: In preparing sections it is advisable to fix, embed, and section eggs while they are still in the capsules.

Whole mounts: Fixation. Obtain decapsulated eggs as outlined above. After freeing the eggs, agitate them by gentle rotary rinsing with a pipette, in order to wash them and concentrate them in the center of the dish. Change the water two or three times. Concentrate the eggs and, using a pipette, transfer them to a vial three-quarters filled with Kleinenberg's picro-sulfuric fixative. Fix the eggs for 15 minutes.

Remove the fixative using a pipette of small diameter, and then fill the vial with 70% alcohol. Wash in 70% alcohol until the eggs are white; it is advisable to avoid a prolonged washing, since the stain employed is best when it does not penetrate the macromeres. The latter should therefore be left slightly acid. Thus, the eggs are removed from 70% alcohol immediately after the last wash which removes no picric acid from them, hydrated in 50% and 35% alcohols and washed thoroughly in two or three changes of water.

Staining. After washing with water, fill the vial with undiluted Mayer's haemalum, and stain for 5 to 10 minutes. For the polar body stages, a staining time of 5 to 7 minutes is usually sufficient. After staining, wash thoroughly in water, dehydrate, and clear in xylol. Remove the xylol used in clearing and replace it with a small amount of thin damar.

Mounting. Coverslips must be supported. For this purpose it is convenient to use paper squares the size of 7/8-inch coverslips. A hole is punched in the center of each square with a paper punch. In mounting, the squares are cleared in xylol, and fixed to the center of the slides by adding three or four drops of thin damar before the xylol evaporates. When the paper mounts have dried, the eggs are removed from the vial, in which they are stored, by the use of a pipette drawn out to a long taper and having a small diameter at its tip. The eggs are allowed to settle toward the tip of the pipette, and one drop of the egg-damar suspension is placed in the center depression of each paper mount. The damar is allowed to dry to the point of formation of a thin film, in order that the eggs may remain dispersed and with the macromere quartet adjacent to the slide when mounted. Apply thick damar to the edge of the paper mount, immerse a #0 coverslip in xylol and apply it to the slide over the paper mount.

An alternative method:

1. Fix for 30 to 120 minutes in Mayer's picro-sulfuric fixative.

2. Wash in 35%, 50%, and 70% alcohols; leave in the latter until the yellow color ceases to come out.

3. 50% and 35% alcohols, to water&endash;5 minutes in each.

4. Stain in Conklin's haematoxylin (one part Delafield's haematoxylin in four or five volumes of distilled water, to which is added one drop of the picro-sulfuric fixative for each ten cc. of the diluted stain): 5 to 10 minutes.

5. Wash in water, dehydrate 5 minutes in each alcohol; 10 minutes in 95% alcohol; two changes of absolute alcohol; xylol.

6. Mount in thick balsam or damar with supported coverslips.

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Methods of Observation

Details of the living eggs and larvae are more distinct against a dark background. Swimming larvae can be mounted on vaselined slides or on slides with supported coverslips. They are usually quite active, but can be tangled in a few shreds of lens paper or lightly anaesthetized with a dilute solution of chloral hydrate. Due to the opacity of the living eggs, the details of maturation, fusion of the germ nuclei, and cleavage are best studied from prepared whole-mounts.

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preparation of Cultures

Eggs removed from the mantle cavity of the female do not develop normally for more than one or two days. However, a complete series of embryos can be obtained by selecting a number of capsules. The young stages appear bright yellow through the capsule, while older embryos are brown.

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procuring Fertilized Ova

The animals can be detached with a heavy knife. If eggs have been deposited, they are found in a transparent capsule, attached to the substrate or to the foot of the female. Mature females which have not yet deposited eggs may be isolated in glass dishes supplied with running sea water. After a few hours (preferably in the early morning), pour off the water and examine the ventral surfaces of the females through the glass. In this way females can be found in the process of oviposition, and the first stages of development can be obtained. Transfer the capsule to a Syracuse dish of sea water and tease it open with needles to release the eggs (Conklin, 1937).

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

These limpets may be kept indefinitely in aquaria or fingerbowls provided with a current of flowing, unfiltered sea water. C. plana will readily attach itself to glass when it is removed from the hermit crab shell. Unless they are already in the adult female phase, these animals eventually differentiate into males and females.

  • Bumpus, H. C., 1898. The breeding of animals at Woods Holl during the months of June, July and August. Science, 8: 850-858.
  • Coe, W. R., 1936. Sexual phases in Crepidula. J. Exp. Zool., 72: 455-477.
  • Coe, W. R., 1938. Conditions influencing change of sex in mollusks of the genus Crepidula. J. Exp. Zool., 77: 401-424.
  • Coe, W. R., 1948. Nutrition and sexuality in protandric gastropods of the genus Crepidula. Biol. Bull., 94: 158-160.
  • Conklin, E. G., 1897. The embryology of Crepidula, a contribution to the cell lineage and early development of some marine gasteropods. J. Morph., 13: 1-226.
  • Conklin, E. G., 1902. Karyokinesis and Cytokinesis in the maturation, fertilization and cleavage of Crepidula and other Gasteropoda. I. Karyokinesis. Ii. Cytokinesis. J. Acad. Nat. Sci., Philadelphia, ser. 2, 12: 1-121.
  • Conklin, E. G., 1937. The genus Crepidula. In: Culture Methods for Invertebrate Animals edit. by Galtsoff et al., Comstock Ithaca, pp. 531-532.
  • Gould, H. N., 1950. Culturing Crepidula plana in running sea water. Science, 111: 602-603.
  • Moritz, C. E., 1938. The anatomy of the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 83-92.
  • Moritz, C. E., 1939. Organogenesis in the gasteropod Crepidula adunca Sowerby. Univ. California Publ. Zool., 43: 217-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common slipper shell

The common slipper shell, Crepidula fornicata, has many other common names, including common Atlantic slippersnail, boat shell, quarterdeck shell, fornicating slipper snail, Atlantic Slipper Limpet and it is known in Britain as the "common slipper limpet". This is a species of medium-sized sea snail, a marine gastropod mollusc in the family Calyptraeidae, the slipper snails and cup and saucer snails.

Description[edit]

10 fresh shells of Crepidula fornicata

The size of the shell is 20–50 mm.[1] The maximum recorded shell length is 56 mm.[2]

This sea snail has an arched, rounded shell. On the inside of the shell there is a white "deck", which causes the shell to resemble a boat or a slipper, hence the common names. There is variability in the shape of the shell: some shells are more arched than others.

Groups of individuals are often found heaped up and fastened together, with the larger, older females below and the smaller, younger males on top. As a heap grows, the males turn into females (making them sequential hermaphrodites).[3]

Distribution[edit]

The species is native to the western Atlantic Ocean, specifically the Eastern coast of North America. It has been introduced accidentally to other parts of the world and has become problematic.

Distribution of Crepidula fornicata ranges from 48°N to 25°N; 97.2°W to 25°W[1] from as far north as Nova Scotia to as far south as the Gulf of Mexico.[1]

Nonindigenous distribution[edit]

Five views of a shell of Crepidula fornicata

It was introduced to the state of Washington.[1] The species was, however, brought to Europe together with the eastern oyster Crassostrea virginica.[1] In Belgium, the first slipper limpet was found on September 28, 1911, attached to an oyster in Ostend, and since the 1930s it is seen as a common species along Belgian coast.[1]

The species is considered an invasive species in Denmark, France, Italy, the Netherlands, Spain, and the United Kingdom, and has also spread to Norway and Sweden.[4] It is known to damage oyster fisheries.[5] The slipper limpet has few to no predators in Europe, and can thrive on several types of hard bottoms and shellfish banks.[1] A continued expansion to the north is probably inhibited by temperature: low temperatures during the winter can slow down or inhibit the development of the slipper limpet.[1]

It has also been introduced to the Pacific Northwest and Japan.[6]

Human consumption[edit]

Culinary use[edit]

Many different avenues can be ventured upon to find the perfect target market and the best way to market these shellfish. Slipper limpets are a versatile food. They have the flavor and individualism to stand alone as a main course, an appetizer or be incorporated into many different dishes. Before, during and after cooking slipper limpets produce a good amount of liquid which can be boiled down into broth or stock. The liquid itself could also be used as a clam juice substitute. We believe these shellfish delicacies have the potential to fill a niche in seafood market. If expressed to the public correctly, people will embrace this new shellfish and a demand for Crepidula fornicate will result in vastly increasing commercial and restaurant sales. Therefore, this shellfish and its recipes could become commercially important in the years to come. Recipes including limpets have been published in Scottish cookbooks; in Hawaii they are considered a delicacy and the Azores highly value them in their cultural dishes.[7]

Although considered an invasive species, there are attempts to harvest and market the snail in France.[8]

Ecology[edit]

Habitat[edit]

This is a common snail, usually found intertidally, infralittoral and circalittoral and in estuaries.[1]

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 70 m.[2]

They are often found, sometimes living stacked on top of one another, on rocks,[1] on horseshoe crabs, shells and on dock pilings.

Feeding habits[edit]

Generally for Calyptraeidae, feeding habits include planktonic and minute detrital food items through either suspension or deposit feeding.[1]

Life cycle[edit]

The species is a sequential hermaphrodite. The largest and oldest animals, at the base of a pile are female, the younger and smaller animals at the top are male. If the females in the stack die, the largest of the males will become a female.[9]

References[edit]

This article incorporates CC-BY-SA-3.0 text from the reference [1]

  1. ^ a b c d e f g h i j k l Gofas, S. (2010). Crepidula fornicata (Linnaeus, 1758). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=138963 on January 13, 2011
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  3. ^ "Crepidula fornicata (Linnaeus, 1758)". CIESM.org. Retrieved 20 February 2015. 
  4. ^ Global Invasive Species Database
  5. ^ Joint Nature Conservation Committee
  6. ^ Marine Life Information Network for Britain and Ireland
  7. ^ Roger Williams University's report.
  8. ^ Lalita Clozel (March 12, 2014), In France, a Quest to Convert a Sea Snail Plague Into a Culinary Pleasure, The New York Times 
  9. ^ Global Invasive Species Database
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!