Overview

Comprehensive Description

Biology/Natural History: Feather stars are primarily suspension feeders. They may walk around using the cirri or swim if dislodged using the arms. Feather stars are deepliving and rarely seen in the Pacific Northwest. Juveniles are stalked like the stalked crinoids (sea lilies).
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feather stars are echinoderms structured somewhat like an upside-down brittle star. The 5 arms often fork near the base to form a total of 10 or more arm branches which are often around 10 cm long. Jointed appendages called pinnules branch from the side of the arms, giving the featherlike appearance. The upper (oral) surface of the arms has an ambulacral groove, and both the mouth and the anus are on the upper side of the central disk. In feather stars (Order Comatulida), the aboral side of the central disk has clawlike cirri which function somewhat like bird feet to grasp the substrate. Tan to reddish tan. Armspread to 25 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

> "As with other species of echinoderms, this species can regenerate parts of the body that have been damaged. A single arm amputated at the base regenerated to a functional one within nine months. The Sunflower Star (Pycnopodia helianthoides) and the Decorator Crab (Oregonia gracilis) prey on this crinoid, and are thought to cause it to cast off its arms as a defense."
*See "Reproduction and Life History" for more information

> "The parasitic flatworm Fallocohospes inchoatus inhabits the intestine of F. serratissima.”

> "The name serratissima is from the Latin serratus, meaning ‘saw teeth.’ "
(Lambert & Austin, 2007, p. 18)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Natividad Island, Baja California, N to the Shumagins and Sannak Island, Alaska. Depth range: 11-1,252 m.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is recorded from the eastern Pacific coast of Panama (see Maluf, 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographical Range: Northern Alaska to Mexico or farther south to off South America.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Diagnosis

Florometra with third syzygy usually between brachials 16+17 (sometimes 15+16). Basal pinnulars of oral pinnules markedly carinate and appearing much broader than rest of pinnule especially in lateral view. Longest cirrals with L/W ratio not more than 2. Longest proximal brachials distinctly broader than long.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymised taxa

Antedon serratissima A. H. Clark, 1907

Heliometra serratissima (A. H. Clark, 1907)

Antedon perplexa A. H. Clark, 1907

Florometra perplexa (A. H. Clark, 1907)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

References and links

Clark, A. H. (1907), Descriptions of new species of recent unstalked Crinoids from the North Pacific Ocean. Proceedings of the United States National Museum 33(1559): 69-84.

Maluf, L. Y. (1988). Composition and distribution of the central eastern Pacific echinoderms. Natural History Museum of Los Angeles County Technical Reports, 2, 1– 242.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: This is the only feather star likely to be encountered in our region.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3373 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3322 samples.

Environmental ranges
  Depth range (m): 46 - 3233.96
  Temperature range (°C): 1.622 - 9.769
  Nitrate (umol/L): 20.014 - 44.880
  Salinity (PPS): 33.614 - 34.664
  Oxygen (ml/l): 0.346 - 3.775
  Phosphate (umol/l): 1.586 - 3.298
  Silicate (umol/l): 20.855 - 177.025

Graphical representation

Depth range (m): 46 - 3233.96

Temperature range (°C): 1.622 - 9.769

Nitrate (umol/L): 20.014 - 44.880

Salinity (PPS): 33.614 - 34.664

Oxygen (ml/l): 0.346 - 3.775

Phosphate (umol/l): 1.586 - 3.298

Silicate (umol/l): 20.855 - 177.025
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: 10-1252 m. This species is mostly found in quite deep water but can be found as shallow as 10 m in some restricted localities such as some places in southern British Columbia.

Habitat: Soft and hard bottoms

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

"...The mature adults release gametes through nipple like swellings on the distal surface of each genital pinnule. Individual females ovulate about 23,800 eggs for a period of about three days each month. The eggs of this and other crinoids are small (around 200 µm) compared to other echinoderms that have non-feeding larvae. Sperm fertilize the eggs in open water and development begins with radial cleavage.
Thirty-five hours after fertilization the young larva (doliolaria) breaks through the fertilization membrane surrounding the egg. By four days, the larva has transverse bands of hair-like cilia for swimming and an adhesive pit at the front end for attaching to the substrate. Soon after this, the larva begins to explore the sea bottom for a place to settle, which could happen right away or be delayed by up to nine days...
Once settled and attached to the substrate, the larva undergoes some rapid changes and resembles a small stalked crinoid (the cystidean stage), although it does not have a mouth yet. About 16 days after settlement, when the larva is about 1.8 mm tall, another transformation takes place. Plates and tube feet begin to form in the mouth region and the animal (in its pentacrinoid stage) begins to feed. It survives in this form for at least six months. Although the transformation into a free-living form has not been observed, in other species of crinoid the hook-like cirri develop around the top of the stalk then the animal detaches from the stalk and leaves it behind" (Lambert & Austin, 2007, p. 18).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Regeneration

“Rate of arm regeneration was measured in caged specimens of the stalkless crinoid Florometra serratissima (A. H. Clark) with one, two, three, and five amputated arms. A single arm amputated at the base regenerates to a fully functional condition in under 9 months. Contrary to earlier speculation, the rate of regeneration per arm decreases slightly as the number of regenerating arms on an individual increases. However, the total rate of regeneration of new arm tissue on an individual increases with increasing number of regenerating arms. An arm amputated midway regenerates at a rate similar to that of an arm amputated near the base. In the population of F. serratissima under study, just under 80% of the individuals had at least one regenerating arm. The potential causes of arm loss are considered and some observations are presented which suggest that the sea star Pycnopodia helianthoides and the crab Oregonia gracilis will attack this feather star and cause it to autotomize arms” (Mladenov, 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: gspence

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Florometra serratissima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAATTAAGTCGTTGGTTGTTTTCTACAAATCATAAGGATATTGGTACTTTGTATTTTCTTTTTGGTGCTTGGGCTGGTATGGTTGGCACTGCTTTAAGAATTATAATTCGTACAGAGTTATCTCAACCTGGTTCTTTTTTAGGAGATGATCAAATTTATAAAGTAATTGTAACTTCTCATGCTTTAATAATGATTTTTTTTATGGTAATGCCAATAATGATAGGTGGTTTTGGTAATTGATTAATTCCTTTAATGATAGGAGCTCCTGATTTGGCTTTTCCTCGTGTAAAAAAAATGAGTTTTTGGTTACTTCCTCCTTCTTTTCTTCTTTTATTAGCTTCTGCTGGTGTAGAAAGGGGTGCTGGTACAGGTTGGACTATTTATCCTCCTTTATCAAGTGGTTTAGCACATTCTGGAGGTTCTGTTGATCTTGCTATTTTTTCTTTACATATTGCTGGTGCTTCTTCTATTGTTGCTTCTATAAATTTTATTACAACTGTAATAAAAATGCGCTCTCCGGGGGTTACTTTTGATCGTTTGCCTTTATTTGTTTGATCTGCTTTTATTACGGCTTTTCTTCTTTTATTATCTCTTCCAGTTTTAGCTGGTGCTATAACTATGCTTCTTACTGATCGTAATATTAATACTACTTTTTTTGATCCGGCTGGTGGTGGTGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATATTCTTATTTTACCTGGTTTTGGTATGATTTCTCATGTTGTAGCTCACTATTCTGGTAAGCAGGAACCTTTTGGGTATTTAGGAATGGTTTATGCTATGGTTGCTATAGGAATTTTAGGTTTTCTTGTTTGGGCTCATCATATGTTTACAGTTGGGATGGATGTGGATACTCGTGCTTATTTTACAGCAGCTACTATGATAATAGCTGTTCCTACTGGAATAAAGGTTTTTAGGTGAATGGCAACTTTACAGGGTTCTAATATTCGTTGAGATGTTCCTTTGTTTTGGGCTTTAGGTTTCATTTTTTTATTTACTTTAGGTGGTTTAACGGGTGTTGTTCTTTCTAATTCTAGTTTAGATATAGTTCTTCATGATACTTATTATGTAGTAGCTCATTTTCATTATGTTCTTTCTATGGGTGCTGTTTTTGCTATTTTTTCTGGTTTTACTCATTGATTTCCTTTATTTTCTGGTGTAGGTTTTCATCCTCAATTAAGAAAGGTTCAATTTTTTATTATGTTTATTGGTGTTAATCTTACTTTTTTTCCTCAACATTTTTTAGGTTTGGCTGGTATGCCTCGTCGTTATGCTGATTATCCTGATGCTTATGTTAGCTGAAATTTAGTTTCTTCTATTGGTTCTATTATTTCTTTAGTTGCTGTTATTTTTTTTATTTTTTTAGTTTGAGAAGCTTTTGTAGTTCGTCGGAGTGTTTTATTACCTAGATATGTAAGTTCTTCTTTAGAATGACAATATAGTTTTTTTCCTCCATCCCACCATACATATAATGAGACTCCTTTTGTTGTTTTAATTAATTCTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Florometra serratissima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!