Strongylocentrotus purpuratus (Stimpson, 1857)

California purple urchin

Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: NOT EVALUATED external link Showing: scientific names

Media Center Navigation

Strongylocentrotus purpuratus (Stimpson, 1857)

Images

Items in yellow are not reviewed.

Choose images

Strongylocentrotus purpuratus (Stimpson, 1857)
Strongylocentrotus purpuratus
Strongylocentrotus purpuratus
Strongylocentrotus purpuratus
Strongylocentrotus purpuratus (Stimpson, 1857)

Page navigation

  

Table of Contents

Barcode

Barcode data

Source and Additional Information
Supplier
Barcode of Life Data Systems (BOLD) external link
Copyright
Some rights reserved external link
Compiler
Sujeevan Ratnasingham external link
Compiler
Paul D.N. Hebert external link
Location
Source URL
View original data object external link
Citation

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
 

GBEH1469-06|NC_001453|Strongylocentrotus purpuratus|

AGACGATGATTATTTTCTACTAACCACAAGGACATCGGAACACTTTATTTAATTTTTGGGGCCTGAGCTGGCATGGTAGGCACAGCTATG---AGTGTGATTATCCGTGCCGAGTTGGCACAACCTGGTTCGCTGCTAAAAGAT---GACCAGATATACAAAGTGGTCGTTACCGCACATGCGCTAGTCATGATTTTCTTCATGGTAATGCCAATAATGATTGGTGGATTTGGGAATTGACTCATTCCACTAATG---ATCGGTGCGCCAGATATGGCCTTCCCCCGCATGAAAAATATGAGTTTTTGACTTATTCCCCCTTCTTTTATATTACTTTTAGCGTCCGCAGGAGTAGAAAAAGGAGCAGGAACTGGCTGAACTATCTACCCTCCTCTCTCTAGTAAAATAACACACGCCGGTAGGTCCGTTGATTTA---GCAATCTTCTCCCTTCACCTGGCCGGTGCCTCTTCCATCTTGGGCCTCATTAAATTTATAACAACAATTATTAATATGCGGACACCGGGGATGTCTTTGGATCGTCTTCCTTTATTCGTCTGATCCGTCTTTGTCACTGCCTTCTTGCTCCTCCTTTCTCTTCCAGTATTAGCAGGA---GCAATTACAATGCTTCTCACAGATCGTAAAATAAACACAACTTTCTTTGACCCTGCAGGAGGGGGAGATCCAATTCTATTTCAACACCTATTCTGGCTTTTTGGACACCCCGAGGTGTATATTCTTATCTTACCGGGATTTGGTATGATCTCACACGTTATAGCTCACTACTCTGGTAAGCGA---GAGCCTTTCGGATACCTGGGGTTGGTTTATGCCATGATTGCAATAGGAGTTTTAGGATTCCTTGTCTGGGCCCACCATATGTTTACAGTAGGGATGG


 
-- end --
 


Download FASTA File
"Strongylocentrotus purpuratus (Stimpson, 1857)". Encyclopedia of Life, available from "http://www.eol.org/pages/598175". Accessed 19 Mar 2010.