Overview

Brief Summary

The Florida harvester ant, Pogonomyrmex badius, is the only of the 22 species of harvester ants (Pogonomyrmex) that occur east of the Mississippi river.  It is native to the Gulf coastal plain from Mississippi to Florida, and the Atlantic coastal plain north to North Carolina.  While found in abundance across their range, they are patchily distributed because Florida harvester ants only nest in dry sand habitats in open areas.  Dry hammocks in open woodlands or grassy areas are especially preferred.  They also regularly build nests on lawns, around gardens, and in fire lanes. 

Florida harvester ants are dark rusty red in color.  Like other members of its genus, Florida harvester ants have a beard-like row of hairs on the under side of its head.  Colonies include several castes of workers, whose sizes vary from 0.6-1 cm (0.25 - 0.4 inches) long.  The soldiers are the largest workers, and are also characterized by having disproportionately large heads.  Each colony has a single, long-lived queen.  Colonies have been recorded as lasting for more than 19 years.  Workers are most active in dry heat (35-40oC, or 95-105oF) and build nests in unshaded areas.  Rains in June-October precipitate mating swarms in which winged reproductive individuals leave the nest to mate with females.  Mated females then form a new colony, and the winged males die. 

Florida harvester ants excavate nests, which delve down to 6 feet (2 meters) deep, in sandy soils.  A nest has one or more entrances in the center of a slight mound 30 - 60 cm (1-2 feet) in diameter, and many underground tunnels and chambers.  The mound is a cleared area, so readily visible.  It is often covered with small pebbles, middens from seed chaff and other waste, and charcoal from burned areas.  Experimental work has shown the charcoal pieces to function as territorial markers that drive away invading aggressor ants of other species. 

Like other harvester ants, P. badius collects seeds for food and stores them in grain chambers in the nest to eat later.  Workers gather seeds of many different plants, including ragweed, crab grass, small crab grass, rough buttonweed, sedge, Paspalium sp., poke weed, red clover, alfalfa, evening primrose, narrow leaf vetch and crotonweed.  The ants will take seeds that have fallen to the ground, and will also harvest seeds growing on the plant.  Workers lay down odor trails to mark paths to food sources. 

Florida harvester ant colonies construct and move into a new nest about once a year.  Often the move is motivated by encroachment of vegetation which shades the old nest, or by aggressors from other ant colonies (both the same and different species) that drive a colony to a different location. 

While Florida harvester ants are not at all aggressive towards and rarely sting humans.  However, they produce a very toxic venom so when they do sting, it is one of the most painful and long-lasting of any ant species.  Florida harvester ants are sometimes considered agricultural pests, causing damage to agricultural crops through their seed harvesting behaviors. 

(Gordon 1984; Harrison and Gentry 1981; Klotz et al. 2005; Nickerson and Fasulo, 2013; Tschinkel 2014)

  • Gordon, D. M., 1984. The harvester ant (Pogonomyrmex badius) midden: refuse or boundary? Ecological entomology, 9(4), 403-412.
  • Harrison, J.S. and Gentry J.B., 1981. Foraging pattern, colony distribution, and foraging range of the Florida harvester ant, Pogonomyrmex badius. Ecol 62: 1467–1473. doi: 10.2307/1941503
  • Klotz, J.H., Schmidt, J.O. and Pinnas, J.L., 2005. Consequences of Harvester Ant Incursion into Urbanized Areas: A Case History of Sting Anaphylaxis. Sociobiology, 45(3).
  • Nickerson, J.C. and Fasulo, T.R., January 2013. Florida Harvester Ant. Featured Creatures. Entomology and Nemotology, University of Florida and IFAS. Retrieved February 4, 2016 from http://entnemdept.ufl.edu/creatures/urban/ants/harvester_ant.htm
  • Tschinkel, W.R. 2014. Nest Relocation and Excavation in the Florida Harvester Ant, Pogonomyrmex badius. PLoS ONE 9(11): e112981 DOI:10.1371/journal.pone.0112981
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Taxonomic History

Formica badia Latreille, 1802a: 238, pl. 11, fig. 71 (w.q.) U.S.A. AntCat AntWiki

Taxonomic history

Lepeletier, 1835: 175 (m.); Wheeler & Wheeler, 1960b PDF: 2 (l.); Taber, Cokendolpher & Francke, 1988 PDF: 51 (k.).
Combination in Aphaenogaster: Roger, 1863b PDF: 30; in Pogonomyrmex: Mayr, 1870b PDF: 971.
Senior synonym of Pogonomyrmex transversa (and its junior synonyms Pogonomyrmex brevipennis, Pogonomyrmex crudelis): Emery, 1895d PDF: 310.
See also: Cole, 1968: 148; Gordon, 1984: 413; Hölldobler & Wilson, 1971: 385; Smith, 1979: 1356.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Known from Florida to North Carolina and west into Mississippi and Louisiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pogonomyrmex badius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATAATCATTCGCCTTGAACTCGGTTCATGTAATAGTTTAATTAATAAT---GAACAAATCTACAATTCTATAGTAACAAGACATGCATTTATTATAATTTTTTTTATAGTTATACCCTTCATAATTGGTGGTTTTGGGAATTTTCTTGTCCCATTAATA---CTTGGAACACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTCCTTCCACCATCAATTTCCTTATTAATTTTAAGAAACTTTATTGGAAGAGGTGTTGGGACTGGTTGAACTATTTATCCTCCTCTTGCCTCAAATATTTTTCATAGAGGCCCTTCAATTGATATATCT---ATTTTCTCTTTGCATATTGCCGGTATATCATCAATTCTTGGAGCAATTAATTTTATTACAACAATTTTAAATATACATCATAAAAATTTTACTATAGATAAAATTCCTCTTTTAGTATGATCTATTCTAATTACCGCAATCCTTTTATTATTATCCCTTCCAGTACTTGCTGGA---GCAATTACCATATTATTAACTGATCGAAACTTAAATACTACATTTTTTGATCCGAGGGGAGGGGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACACCCCGAAGTTTATATTCTTATTCTACCTGGATTTGGATTAATTTCACATATTATTATAAATGAAAGGGGGAAAAAA---GAAACTTTTGGCTCTTTAGGTATAATTTATGCAATAATCGCAATTGGATTTTTAGGTTTTATTGTATGAGCTCACCATATATTTACAATCGGATTAGATGTAGATACCCGAGCTTACTTCACCTCAGCTACAATAATTATTGCAATTCCAACTGGTATTAAAATTTTTAGATGAATTTCC---ACGCTTCATGGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pogonomyrmex badius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pogonomyrmex badius

Pogonomyrmex badius, or the Florida harvester ant, is a species of harvester ant in the genus Pogonomyrmex.[1] It is the only Pogonomyrmex species found on the east coast of the United States.[2]

References[edit]

  1. ^ Bolton, B. (2015). "Pogonomyrmex badius". AntCat. Retrieved 30 January 2015. 
  2. ^ Cole, A. C., Jr. (1968). Pogonomyrmex harvester ants. A study of the genus in North America. Knoxville, Tennessee: University of Tennessee Press. p. 222. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!