Overview

Brief Summary

Living Material

Bugula fabellata is found on the lower surfaces and edges of horizontal submerged timbers in Eel Pond, at Woods Hole, Mass.; B. turrita is found in similar habitats in Vineyard Sound or on the rocks at Stony Beach. Colonies of B. turrita are about 30 cm. high, yellow in color, and composed of flat branches growing in spirals. The flesh-colored colonies of B. flabellata are slightly shorter and are composed of broad, flat branches, each of which contains three to seven rows of zooecia. Both species have stalked avicularia shaped like birds' heads. Ripe colonies can be recognized by the prominent ovicells.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Living Material

Bugula fabellata is found on the lower surfaces and edges of horizontal submerged timbers in Eel Pond, at Woods Hole, Mass.; B. turrita is found in similar habitats in Vineyard Sound or on the rocks at Stony Beach. Colonies of B. turrita are about 30 cm. high, yellow in color, and composed of flat branches growing in spirals. The flesh-colored colonies of B. flabellata are slightly shorter and are composed of broad, flat branches, each of which contains three to seven rows of zooecia. Both species have stalked avicularia shaped like birds' heads. Ripe colonies can be recognized by the prominent ovicells.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Bugula flabellata is an erect bryozoan that forms low dense tufts, between 2 – 3 cm in height. The colonies are made up of a number of fan-shaped shoots that are dichotomously divided into flat wedge-shaped branches, broadening at the tip. The branches are arranged in a somewhat circular manner and often slightly convoluted. When living the colony is of a buffish colour, but turns grey when dried.

The species almost invariably attaches to other bryozoans. Even when it is apparently growing on rock or shell, closer examination usually shows the exact site of attachment to be some species of encrusting cheilostomate bryozoan. Bryozoan species commonly supporting colonies of B. flabellata include Porella concinna, Schizomavella auriculata, Schizomavella linearis, Cellepora pumicosa, fronds of Flustra foliacea and lobes of Alcyonidium diaphanum. Small modified zooids which resemble rootlets (rhizoids) are used to attach to the colony to the substrate. The species often occurs as a co-dominant with Chartella papyracea in communities colonizing vertical shaded, sublittoral rock surfaces in the Bristol Channel.

Bugula flabellata is relatively common on the lower intertidal area of rocky shores, extending down to shallow inshore waters. The species apparently has a wide geographic distribution and occurs throughout the North Sea and off all British coasts.
The species appears to be a successful fowler, and its arrival and spread has been recorded in New Zealand ports. On the east coast of America, Bugula simplex was long mistaken for Bugula flabellata.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sally Rouse

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Bugula flabellata forms an erect, densely tufted, branched colony about 2-5 cm in height and is a buff colour when living, grey when dried. The branches are broad, flat and wedge-shaped, and composed of rows of four or more zooids, somewhat circularly disposed. Individual zooids are rectangular in shape and 0.5-0.8 x 0.2 mm. Zooids at the margin of the branches bear 3 spines on the outer distal corner and 2 on the inner distal corner. Inner zooids bear 2 spines on each distal corner. The front of the zooid is almost entirely membranous. The polypide has 14 tentacles. Avicularia are present on inner and marginal zooids, being larger on the latter, with the beak hooked rectangularly. Brood chambers (ooecia) are sub-globular and conspicuous. Colonies are attached to the substratum by extensions of the basal zooids termed rhizoids. Yellow embryos are present from early May to October. The newly settled larvae form ancestrula with 3 proximal spines and 3 spines on each distal angle.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Haast altijd op andere Bryozoa, zelfs als ze schijnbaar groeien op rotsen of schelpen. Loppens (1906) vermeldt deze soort als algemeen op Flustra foliacea, stenen en schelpen en in de haven van Nieuwpoort sublitoraal op havenconstructies. De grote hoeveelheid materiaal op Flustra foliacea in het KBIN doet vermoeden dat deze soort in het begin van de 20ste eeuw veel algemener was dan nu. Recent in België op aangespoelde Flustra foliacea en plastic voorwerpen. Tijdens een campagne op de Hinderbanken in 2005 werd op slechts één plaats Bugula flabellata aangetroffen. De achteruitgang van Flustra ligt mogelijks aan de basis van een achteruitgang van Bugula flabellata. Bijzonder weinig waarnemingen uit Nederland: aangespoeld in Scheveningen op kurk (Lacourt, 1949), in september 2003 bij Callantsoog (de Ruijter, 2003b) en in augustus 2005 bij Egmond aan Zee (de Ruijter, 2006a).
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

lower St. Lawrence estuary
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Vormt een laag, dicht bosje van 2-3 cm hoog, van geelachtige kleur bij levende, maar grijs of bruin wordend bij droging. Takken breed, distaal het breedst, ietwat cirkelvormig gerangschikt. Zoïden in 3 tot 8 rijen, langwerpig, van gelijke breedte blijvend, het membraan neemt geheel of het grootste deel in van het frontaal oppervlak. Stekels 3:2 (2:2 op binnenste zoïden), van variabele grootte; deze op de marginale zoïden soms heel groot. Polypide met 14 tentakels. Avicularia aanwezig op zoïden van binnenste en marginale rijen, laatstgenoemde aanzienlijk groter; vastgehecht 1/3 tot halfweg naar beneden langs de zijkant; bek rechthoekig haakvormig. Broedkamers bijna bolvormig; embryo’s geel, van mei tot oktober. Ancestrula met 3 proximale stekels en 3 op elke distale hoek.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Occurs on the lower shore and shallow sublittoral rocky shore. Usually attached to other bryozoan species such as Porella concinna, Schizomavella auriculata, Schizomavella linearis and Cellepora pumicosa, as well as the fronds of Flustra foliacea and the lobes of Alcyonidium diaphanum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Later Stages of Development

The ciliated larvae of the two species of Bugula found around Woods Hole are almost spherical and measure approximately 180 microns. Larvae of both species have a stiff circle of cilia surrounding a convex apical organ on the pole which is carried foremost in swimming. The opposite pole is depressed and bears a central invagination called the internal sac. This depression extends up one side of the larva to the equator in the form of a glandular groove. At the apex of this groove is a tuft of long flagella (the vibratile plume). The lateral groove and the plume make up the so-called "pyriform organ." The larva of B. turrita has, in addition, four or six eyespots: two or four located on the anterior borders of the lateral groove, and two on the opposite side. When they are first released, the larvae are strongly attracted by light, but after two or three hours, they gradually become negatively phototropic. If they are left undisturbed, the larvae also show a moderate negative geotropism. After a swimming period of four to six hours, the larva attaches. A temporary attachment is first made by the lateral groove; then the internal sac is suddenly everted and fastened to the substrate. About an hour after fixation, the larva begins to elongate, and in four to eight hours the body cavity is visible and the first polyp begins to form. The primary zoid is completely formed in 24 hours. From this time on, secondary individuals are produced rapidly by asexual budding, until a large colony is formed. Sexual maturity is attained about one month after attachment.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Early Stages of Development

Taxonomic confusion makes it uncertain whether the species B. flabellata found at Woods Hole is identical with B. calathus, studied by Vigelius (1886). If the two species are identical, the animals are hermaphroditic, and the internally fertilized eggs are transferred to ooecia where development occurs. The cleavages are regular and equal as far as the 32-cell stage, producing a flat, two-layered plate of cells. Gastrulation is probably by epiboly, and further development leads to the formation of a rather degenerate free-swimming larva.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Later Stages of Development

The ciliated larvae of the two species of Bugula found around Woods Hole are almost spherical and measure approximately 180 microns. Larvae of both species have a stiff circle of cilia surrounding a convex apical organ on the pole which is carried foremost in swimming. The opposite pole is depressed and bears a central invagination called the internal sac. This depression extends up one side of the larva to the equator in the form of a glandular groove. At the apex of this groove is a tuft of long flagella (the vibratile plume). The lateral groove and the plume make up the so-called "pyriform organ." The larva of B. turrita has, in addition, four or six eyespots: two or four located on the anterior borders of the lateral groove, and two on the opposite side. When they are first released, the larvae are strongly attracted by light, but after two or three hours, they gradually become negatively phototropic. If they are left undisturbed, the larvae also show a moderate negative geotropism. After a swimming period of four to six hours, the larva attaches. A temporary attachment is first made by the lateral groove; then the internal sac is suddenly everted and fastened to the substrate. About an hour after fixation, the larva begins to elongate, and in four to eight hours the body cavity is visible and the first polyp begins to form. The primary zoid is completely formed in 24 hours. From this time on, secondary individuals are produced rapidly by asexual budding, until a large colony is formed. Sexual maturity is attained about one month after attachment.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Early Stages of Development

Taxonomic confusion makes it uncertain whether the species B. flabellata found at Woods Hole is identical with B. calathus, studied by Vigelius (1886). If the two species are identical, the animals are hermaphroditic, and the internally fertilized eggs are transferred to ooecia where development occurs. The cleavages are regular and equal as far as the 32-cell stage, producing a flat, two-layered plate of cells. Gastrulation is probably by epiboly, and further development leads to the formation of a rather degenerate free-swimming larva.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding Season

At Woods Hole, these animals have been found to release larvae from the first or second week of June until November 1 (Grave, 1930).

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding Season

At Woods Hole, these animals have been found to release larvae from the first or second week of June until November 1 (Grave, 1930).

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bugula flabellata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATATTTTTTATTTNNNTTATGATCTGGGATAATTGGAAGAGGNTTAAGAGCCCTAATTCGAGTAGAGCTAAGACAGCCCGGCAGATTATTAGGCAAC---GACCAACTCTATAATGTAATCGTGACANNNNNTGGATTCCTAATAATTTTCTTCATAGTTATACCAGTAATAATTGGGGGATTCGGAAACTGATTGGTCCCTCTTATACTGGGCTGCCCTGATATAGCTTTCCCCCGACTAAATAATATAAGATTTTGGCTTTTACCTCCCGCCTTAGCACTACTTTTAATATCTTCATTAGTAGAAAGGGGCGCCGGAACCGGATGGACTGTATACCCCCCTCTTTCATCTAACTTGGGACATAGAGGACCTTCCGTTGATCTAGCAATCTTTTCACTACATCTGGCTGGAGCCTCATCAATTTTAGGGGCTATCAACTTCATAACATCCACCTTAAACATACGAAATGAGTACATAACTATAATACACATTCCTCTTCTAGTATGGGCAGTCTTTATTACCGCAGTACTTCTGCTTCTATCCCTACCAGTCCTAGCAGGCGCCATTACAATACTACTAACCGACCGAAACCTAAACACATCCTTTTTTGACCCCGCAGNTGGTGGAGACCCTATTCTCTATCAACACCTCTTCTGATTTTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bugula flabellata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Methods of Observation

Early stages of development can be obtained only by dissection of the ovicells, but larvae are easily obtained. Breeding colonies should be collected on the afternoon of the day previous to that on which they will be used. If they are placed in fingerbowls of sea water and left overnight in front of a window, the larvae will be released some time between 5 and 10 A.M. the next morning. If the fingerbowl is left in a dark-room during the night, the larvae will not be released at dawn, but will be retained until the colony is exposed to light. However, this release of larvae in response to light decreases after noon. The released larvae, which gather at the lighted side of the dish, can be pipetted to fingerbowls or other receptacles where they will attach. After attachment, the larvae should be transferred to vessels provided with running sea water, if further development is desired.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

The animals should be provided with running sea water.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Methods of Observation

Early stages of development can be obtained only by dissection of the ovicells, but larvae are easily obtained. Breeding colonies should be collected on the afternoon of the day previous to that on which they will be used. If they are placed in fingerbowls of sea water and left overnight in front of a window, the larvae will be released some time between 5 and 10 A.M. the next morning. If the fingerbowl is left in a dark-room during the night, the larvae will not be released at dawn, but will be retained until the colony is exposed to light. However, this release of larvae in response to light decreases after noon. The released larvae, which gather at the lighted side of the dish, can be pipetted to fingerbowls or other receptacles where they will attach. After attachment, the larvae should be transferred to vessels provided with running sea water, if further development is desired.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

The animals should be provided with running sea water.

  • Corrêa, D., 1948. A embriologia de Bugula flabellata. Universidade de Sao Paulo Boll a. Fact Fill, Ciên., e Let., Zool., 13: 7-73.
  • Grave, B. H., 1930. The natural history of Bugula flabellata at Woods Hole, Massachusetts, including the behavior and attachment of the larva. J. Morph., 49: 355-383.
  • Grave, B. H., 1937. Bugula flabellata and B. turrita. In: Culture Methods for Invertebrate Animals, edit. by Galtsoff et al., Comstock, Ithaca, pp. 178-179.
  • Hasper, M., 1912. On a method of rearing larvae of Polyzoa. J. Mar. Biol. Assoc., 9: 435-436.
  • Lynch, W. F., 1947. The behavior and metamorphosis of the larva of Bugula neritina (Linnaeus): Experimental modification of the length of the free-swimming period and the responses of the larvae to light and gravity. Biol. Bull., 92: 115-150.
  • Lynch, W. F., 1952. Factors influencing metamorphosis of Bugula larvae. Biol. Bull., 103: 369-383.
  • Lynch, W. F., 1955. Synergism and antagonism in the induction of metamorphosis of Bugula larvae by neutral red dye. Biol. Bull., 109: 82-98.
  • Mawatari, S., 1951. The natural history of a common fouling bryozoan Bugula neritina (L.). Misc. Reps. Res. Inst. Natural Resources, Nos. 19-21, Keita Shibata Memorial Numbers, Feb., 1951, pp. 47-54.
  • Mcdougall, K. D., 1943. Sessile marine invertebrates of Beaufort, North Carolina. A study of settlement, growth, and seasonal fluctuations among pile-dwelling organisms. Ecol. Monog., 13: 321-374.
  • Miller, M. A., 1946. Toxic effects of copper on attachment and growth of Bugula neritina. Biol. Bull., 90: 122-140.
  • Vigelius, W. J., 1886. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 6: 499-541.
  • Vigelius, W. J., 1888. Zur Ontogenie der mariner Bryozoen. Mitt. Zool. Stat., Neapel, 8: 374-376.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Egg Characteristics and Breeding Season for Woods Hole Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!