Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

Fulica cornuta is known from a few high altitude Andean lakes in south-west Bolivia (Oruro in 1903, Potos), north Chile (Tarapac, Antofagasta, Atacama), and north-west Argentina (Jujuy, Salta, Catamarca in 1918, Tucumn, San Juan) (Haene and Montaez 1996). Large concentrations have been recorded only occasionally, most notably 8,988 in the Vilama and Pululos area of Argentina in October 1995 (TWSG News 9 1996: 34-39), and 2,800 birds on Laguna Pelada, Bolivia, in November 1989 (Cabot and Serrano 1982). It normally occurs at low densities, with 1-10 nesting pairs at most sites, and up to 70-90 at a few (Taylor 1996, TWSG News 9 1996: 34-39). The Chilean population is estimated at 620 birds (Glade 1988), and Bolivia seems to hold a healthy population (Rocha and Quiroga 1996). The global population is likely to be in the range of 10,000-19,999 individuals. There is no definite evidence of a recent decline (Taylor 1996), but local populations are believed to fluctuate greatly between periods of drought and inundation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

High Andean lakes of sw Bolivia to n Chile and nw Argentina.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits high altitude Andean lakes, with dense submerged aquatic plants, primarily at 3,000-5,200 m but as low as 2,000 m in harsh weather.


Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fulica cornuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTCTACTTAATTTTCGGAGCCTGAGCCGGCATAATCGGCACCGCCCTCAGCCTGCTTATCCGAGCAGAATTAGGACAACCCGGCACCCTCCTAGGAGATGACCAAATTTACAATGTAATTGTCACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGCTTCGGCAACTGACTAGTACCTCTCATAATCGGAGCCCCAGACATAGCATTTCCCCGCATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTACTACTCCTAGCATCATCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACAGTTTACCCCCCACTAGCCGGCAACCTAGCACATGCAGGCGCCTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGCGTCTCATCTATCCTAGGCGCCATTAATTTTATTACAACTGCCATCAACATAAAACCACCCGCTCTATCCCAATATCAAACTCCCCTATTCGTATGATCTGTCCTCATCACCGCTGTTCTACTACTACTATCCCTTCCTGTCCTTGCCGCCGGCATTACCATACTACTAACTGACCGAAACCTAAATACCACATTCTTCGACCCAGCTGGAGGAGGTGACCCTATCCTGTACCAACACCTCTTCTGATTTTTCGGACACCCAGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fulica cornuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a moderately small global population which may be declining owing to habitat degradation and hunting. It is consequently classified as Near Threatened.


History
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Lower Risk/near threatened (LR/nt)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Threatened (T)