Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Coccyzus americanus

More often heard than seen, the Yellow-billed Cuckoo (11-13 inches) is most easily separated from the similar Black-billed Cuckoo (Coccyzus erythropthalmus) by its reddish-brown wing patches, white-and-black under-tail pattern, and the yellow on its bill. Other field marks include a long tail, thin body, and black legs. Male and female Yellow-billed Cuckoos are similar at all seasons. The Yellow-billed Cuckoo breeds across much of the eastern U.S. and southern Canada. Smaller numbers breed west of the Great Plains, in Mexico, and in the West Indies. All Yellow-billed Cuckoos spend the winter in South America. Yellow-billed Cuckoos breed in forests with plentiful undergrowth and clearings, particularly those near water. On migration, this species may be found in habitat similar to that inhabited during the summer months. Wintering Yellow-billed Cuckoos inhabit humid tropical forest. The diet of this species is composed primarily of large insects, including grasshoppers, cicadas, and caterpillars. Like many cuckoos, the Yellow-billed Cuckoo spends much of its time hidden in thick vegetation, where it is not easily seen. Lucky birdwatchers may observe this species slinking through the branches of tall trees while foraging for insect prey. Yellow-billed Cuckoos are primarily active during the day, but like many migratory birds, this species migrates at night.

Threat Status: Least Concern

  • Coccyzus americanus. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Hughes, Janice M. 1999. Yellow-billed Cuckoo (Coccyzus americanus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/418
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Yellow-billed Cuckoo (Coccyzus americanus). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • eBird Range Map - Yellow-billed Cuckoo. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Yellow-billed cuckoos are found in the Nearctic and Neotropical regions. They breed throughout eastern North America, in southeast Canada, northern Mexico and the Greater Antilles. They winter primarily in South America (Peru, Bolivia and northern Argentina).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Hughes, J. 1999. Yellow-billed cuckoo (Coccyzus americanus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 418. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The breeding range extends from interior California to southern Idaho, southeastern Montana, the Dakotas, southern Manitoba (rarely), Minnesota, and New Brunswick, and south to southern Baja California, southern Arizona, Coahuila, Chihuahua, Nuevo Leon, Tamaulipas, the U.S. Gulf Coast, and the Florida Keys; sporadically farther south in Mexico and in the Greater Antilles (AOU 1998). The species is uncommon on Cuba, Hispaniola, and Puerto Rico; rare in the Virgin Islands, Jamaica, and northern Lesser Antilles (Saint Martin)m and possibly occurs in the Bahamas and Lesser Antilles (Raffaele et al. 1998). Yellow-billed cuckoos formerly nested in British Columbia, Washington, and Oregon. Based on Breeding Bird Survey data (Sauer et al. 2008), this species is most abundant in the south-central United States (Kansas and Missouri southward to Texas and Mississippi). During the nonbreeding season, yellow-billed cuckoos occur from southern Central America (rare and local in Costa Rica) and northern South America (and Trinidad and Tobago) south to eastern Peru, Bolivia, and northern Argentina (AOU 1998) and occur rarely in the West Indies (Raffaele et al. 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Yellow-billed cuckoos are found in the Nearctic and Neotropical regions. They breed throughout eastern North America, in southeast Canada, northern Mexico and the Greater Antilles. They winter primarily in South America (Peru, Bolivia and northern Argentina).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Hughes, J. 1999. Yellow-billed cuckoo (Coccyzus americanus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 418. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Canada to Mexico and West Indies; winters to n Argentina.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Yellow-billed cuckoos are medium birds (26 to 30 cm long; 55 to 65 g) with long tails. They have uniform grayish-brown plumage on their head and back, and dull white underparts. Their tails are long with two rows of four to six large white circles on the underside. The bill of yellow-billed cuckoos is short to medium in length and curved downward with a black upper mandible and a yellow or orange lower mandible. Yellow-billed cuckoos have zygodactylous feet, meaning that of the four toes, the middle two point forward and the outer two point backward. (Parker)

Female yellow-billed cuckoos are slightly larger than males. Juveniles are similar in appearance to adults, but have a less distinct undertail pattern, and have cinnamon brown wing coverts.

There are two recognized subspecies of Coccyzus americanus; Coccyzus americanus americanus (the eastern version) and its western counterpart, Coccyzus americanus occidentalis. These two subspecies are differentiated by tail, wing and bill length.

Range mass: 55 to 65 g.

Range length: 26 to 30 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Yellow-billed cuckoos are medium birds with long tails. They are 26 to 30 cm long and weigh 55 to 65 g. They have grayish brown heads and backs and dull white underparts. Their tails are long and have two rows of large white circles on the underside. Yellow-billed cuckoos have a curved bill with a black upper mandible and a yellow or orange lower mandible. On each foot, two toes point forward, and two toes point backward. This is called zygodactylous feet.

Female yellow-billed cuckoos are a little bit bigger than males. Young cuckoos look like adults, but are more reddish-brown on their wings. Also, the tail spots on young cuckoos are less clear.

Range mass: 55 to 65 g.

Range length: 26 to 30 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 31 cm

Weight: 64 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow-billed cuckoos prefer open woodlands with clearings and a dense shrub layer. They are often found in woodlands near streams, rivers or lakes. In North America, their preferred habitats include abandoned farmland, old fruit orchards, successional shrubland and dense thickets. In winter, yellow-billed cuckoos can be found in tropical habitats with similar structure, such as scrub forest and mangroves.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Open woodland (especially where undergrowth is thick), parks, deciduous riparian woodland; in the West, nests in tall cottonwood and willow riparian woodland. Nests in deciduous woodlands, moist thickets, orchards, overgrown pastures; in tree, shrub, or vine, an average of 1-3 meters above ground (Harrison 1979). Subspecies OCCIDENTALIS requires patches of at least 10 hectares (25 acres) of dense riparian forest with a canopy cover of at least 50 percent in both the understory and overstory; nests typically in mature willows (Biosystems Analysis 1989).

NONBREEDING: forest, woodland, and scrub. Also mangroves in Puerto Rico (Raffaele 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow-billed cuckoos live in open areas with some trees and dense shrubs. They are often found near streams, rivers or lakes. In North America, they live in habitats such as old farms and fruit orchards, shrubby fields and thickets. In winter, yellow-billed cuckoos live in tropical habitats with dense shrubs, such as scrub forest and mangroves.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates regularly through the southern U.S., Middle America, and West Indies (sometimes large numbers in fall in Puerto Rico, Raffaele 1983). Birds from North America may migrate through Puerto Rico, but a small breeding population may be resident all year (Kepler and Kepler 1978). Migrants noted in April-May in Jamaica (Lack 1976). Migrates through Costa Rica mid-August to early November and late April-early June (Stiles and Skutch 1989). Arrives in California breeding grounds usually in early June (Biosystems Analysis 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Yellow-billed cuckoos primarily eat large insects including caterpillars (order Lepidoptera), katydids, cicadas (family Cicadidae), grasshoppers and crickets (order Orthoptera). They also occasionally eat bird eggs, snails, small vertebrates such as frogs (Order Anura) and lizards (suborder Sauria) and some fruits and seeds. Parents feed their chicks regurgitated insects (Ehrlich et al.).

Animal Foods: amphibians; reptiles; eggs; insects; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly caterpillars; also other insects, some fruits, sometimes small lizards and frogs and bird eggs (Terres 1980). Gleans food from branches or foliage, or sallies from a perch to catch prey on the wing (Ehrlich et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Yellow-billed cuckoos primarily eat large insects including caterpillars (order Lepidoptera), Orchelimum vulgare, cicadas (family Cicadidae), grasshoppers and crickets (order Orthoptera). They also occasionally eat bird eggs, snails, small vertebrates such as frogs (Order Anura) and lizards (suborder Sauria) and some fruits and seeds. Parents feed their chicks regurgitated insects (Ehrlich et al.).

Animal Foods: amphibians; reptiles; eggs; insects; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Yellow-billed cuckoos affect the populations of the species they prey on. They are also host to internal and external parasites.

Yellow-billed cuckoos are also nest parasites, and may affect the reproductive success of species that they parasitize. Some yellow-billed cuckoos parasitize other birds by laying eggs in their nests. They may lay eggs in the nest of other yellow-billed cuckoos, or in the nests of other bird species, including black-billed cuckoos, American robins, gray catbirds and wood thrushes. If the parasitized parents raise the foreign young, their own chicks may be less likely to survive or flourish.

Ecosystem Impact: parasite

Species Used as Host:

  • American robins
  • gray catbirds
  • wood thrushes
  • black-billed cuckoos

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult yellow-billed cuckoos are killed by raptors, including Aplomado falcons (Falco femoralis) and red-shouldered hawks (Buteo lineatus). Remains of adults have also been found in the stomach of a tiger shark (Galeocerdo cuvier). Nestlings and eggs are vulnerable to predation by snakes such as the black racer (Coluber constrictor), small mammals such as eastern chipmunks (Tamias striatus), and birds such as blue jays (Cyanocitta cristata) and common grackles (Quiscalus quiscula).

When threatened by a predator, yellow-billed cuckoos often hide themselves among vegetation and remain motionless. If a nest is threatened, parents will either attack the predator or try to lure the predator away from the nest by flying away and performing a distracting display and vocalizations.

Known Predators:

  • red-shouldered hawks (Buteo lineatus)
  • tiger sharks (Galeocerdo cuvier)
  • snakes (Serpentes)
  • black racers (Coluber constrictor)
  • eastern chipmunks (Tamias striatus)
  • blue jays (Cyanocitta cristata)
  • common grackles (Quiscalus quiscula)
  • Aplomado falcons (Falco femoralis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Yellow-billed cuckoos affect the insect species that they eat. They provide habitat for many different species of parasites.

Yellow-billed cuckoos are nest parasites. Sometimes they lay their eggs in other birds’ nests. When this happens, the other birds’ chicks may suffer because there are too many chicks in the nest.

Ecosystem Impact: parasite

Species Used as Host:

  • Turdus americanus
  • Dumetella carolinensis
  • Hylocichla mustelina
  • Coccyzus erythropthalmus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adult yellow-billed cuckoos are killed by raptors, including Aplomado falcons (Falco_femoralis) and red-shouldered hawks (Buteo_lineatus). They have also been eaten by a tiger shark (Galeocerdo_cuvier). Nestlings and eggs are eaten by Serpentes such as the black racer (Coluber_constrictor), small mammals such as eastern chipmunks (Tamias_striatus), and birds such as blue jays (Cyanocitta_cristata) and common grackles (Quiscalus_quiscula).

When a predator is nearby, yellow-billed cuckoos hide themselves among vegetation and stand very still. If a predator is near their nest, parents either attack the predator or try to get the predator away from the nest by flying away and performing a distracting display and calling.

Known Predators:

  • red-shouldered hawks (Buteo_lineatus)
  • tiger sharks (Galeocerdo_cuvier)
  • snakes (Serpentes)
  • black racers (Coluber_constrictor)
  • eastern chipmunks (Tamias_striatus)
  • blue jays (Cyanocitta_cristata)
  • common grackles (Quiscalus_quiscula)
  • Aplomado falcons (Falco_femoralis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by hundreds of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but is likely to be considerably more than 10,000 pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Territory size averages 20-24 hectares (S. Laymon, in Riparian Habitat Joint Venture 2000).

Known predators of adults include Aplomado Falcon (FALCO FEMORALIS), Red-shouldered Hawk (BUTEO LINEATUS), and other raptors; of eggs and young include Blue Jay (CYANOCITTA CRISTATA), Common Grackle (QUISCALUS QUISCULA), Black Racer (COLUBER CONSTRICTOR) and Eastern Chipmunk (TAMIAS STRIATUS) (Hughes 1999). Occasional host for Brown-headed Cowbird (MOLOTHRUS ATER), Bronzed Cowbird (MOLOTHRUS AENEUS), and Black-billed Cuckoo (COCCYZUS ERYTHROPTHALMUS) (Hughes 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Yellow-billed cuckoos primarily use vocalizations to communicate. They are generally silent birds during the winter and migration, but vocalize regularly during the early breeding season before the chicks fledge. These birds are able to make at least 6 vocal sounds, which are used for a wide variety of social situations. Few physical displays have been noted in this species.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Yellow-billed cuckoos use calls to communicate. They are usually silent birds during the winter and migration. However, during the breeding season, they call often to communicate with their mate and their chicks. These birds are able to make at least 6 sounds, which they use to communicate many different things.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is little information available about the lifespan and survivorship of yellow-billed cuckoos. The oldest re-captured banded yellow-billed cuckoos were 4 years old at re-capture.

Average lifespan

Status: wild:
4 years.

Average lifespan

Status: wild:
60 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Yellow-billed cuckoos can live to be at least 4 years old in the wild.

Average lifespan

Status: wild:
4 years.

Average lifespan

Status: wild:
60 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Rohwer et al. (2009) provided evidence that Yellow-billed Cuckoos and four other species of Neotropical migrants are what they term "migratory double breeders". These four species are all known to breed in the United States and Canada and to winter in the New World tropics. The new data from Rohwer et al suggest that, following their northern breeding season, these species have a second breeding season in mid-summer in western Mexico before continuing their southward migration to wintering grounds in Central and South America. Only a very few other bird species are known to consistently breed in two different regions in a single year, and the Yellow-billed Cuckoo and the other species discussed by Rohwer et al. are the first known examples from the New World and the first known to have a second breeding season after a southward migration following a first bout of breeding. It is unknown what proportion of Yellow-billed Cuckoo individuals in northern breeding populations attempt a second round of breeding hundreds or thousands of kilometers to the south in Mexico, but the phenomenon may be quite common. This second bout of breeding could be especially important to the viability of western Yellow-billed Cuckoo populations (which have declined dramatically during the last century) because dry conditions west of the Rocky Mountains dramatically reduce primary productivity in midsummer, precisely when food becomes abundant in west Mexico (Rohwer et al. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Yellow-billed cuckoos are probably monogamous, though their breeding system has not been well studied. Breeding pairs form in May or June, and pairs may visit prospective nest sites together before choosing a location. Males may attempt to procure or keep a mate by offering sticks and other nest materials to their mate as well as feeding them (Eaton, Erlich et al).

Mating System: monogamous

Yellow-billed cuckoos begin breeding in mid- to late-May. Most populations breed once per year, though some eastern populations may raise two broods in one breeding season. The male and female build the nest, which is made of twigs, lined with roots and dried leaves, and rimmed with pine needles. The female may begin laying eggs before nest construction is complete. She lays 1 to 5 (usually 2 or 3) light blue eggs, and begins incubating after the first egg is laid. Incubation is done by both parents, and lasts 9 to 11 days.

Yellow-billed cuckoo chicks are altricial at hatching, and are brooded often by the parents for the first week or so. Both parents feed the chicks, which begin to leave the nest 7 to 9 days after hatching. They begin to fly about 21 days after hatching. Soon thereafter they leave the nest for good. The male will usually take care of the first fledgling, and the female will care for the rest (Ehrlich et al.). There is little information available on when yellow-billed cuckoo chicks become independent from their parents. Most yellow-billed cuckoos begin breeding at age 1.

Some yellow-billed cuckoos may parasitize other birds by laying eggs in the nest of other parents. They may lay eggs in the nest of other yellow-billed cuckoos, or in the nests of other bird species, including black-billed cuckoos, American robins, gray catbirds and wood thrushes.

Breeding interval: Most populations breed once per year, though some eastern populations may lay two broods in one breeding season.

Breeding season: Yellow-billed cuckoos begin breeding in mid- to late-May

Range eggs per season: 1 to 5.

Average eggs per season: 2 to 3.

Range time to hatching: 9 to 11 days.

Range fledging age: 7 to 9 days.

Average age at sexual or reproductive maturity (female): 1 minutes.

Average age at sexual or reproductive maturity (male): 1 minutes.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 3.

Male and female yellow-billed cuckoos incubate eggs, brood and feed chicks and protect the nest from predators. They also keep the nest clean by removing the fecal sacs of the chicks. After chicks have left the nest, the parents continue to feed them until they are able to care for themselves. The length of this period is unknown.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Hughes, J. 1999. Yellow-billed cuckoo (Coccyzus americanus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 418. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding often coincides with the appearance of massive numbers of cicadas, caterpillars, or other large insects (Ehrlich et al. 1992). Clutch size is one to five (commonly two to three), largest when prey is abundant. Clutch sizes greater than six attributable to more than one female laying in nest (Hughes 1999). Incubation lasts 9-11, shared by male and female during day; male incubates at night (Hamilton and Hamilton 1965, Potter 1980, Potter 1981). Young are tended by both parents, climb in branches at seven-nine days. Sometimes lays eggs in the nests of Black-billed Cuckoo (COCCYZUS ERYTHROPTHALMUS) or (rarely) other species (Ehrlich et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow-billed cuckoos are probably monogamous (one male with one female). Breeding pairs form in May or June. A pair may visit many locations together before deciding where to build their nest. Males try to attract a female by offering her food or sticks and other nest materials.

Mating System: monogamous

Yellow-billed cuckoos begin breeding in mid- to late-May. Most cuckoos breed once per year, though some may raise two broods in one breeding season. The male and female parents work together to build the nest, which is made of twigs, roots, dried leaves and pine needles. The female may begin laying eggs before the nest is complete. She lays 1 to 5 (usually 2 or 3) light blue eggs, and begins incubating after the first egg is laid. Both parents incubate the eggs, which hatch after 9 to 11 days.

Yellow-billed cuckoo chicks are helpless when they hatch. The parents must brood them for the first week or so. Both parents also feed the chicks. The chicks begin to leave the nest after 7 to 9 days. They begin to fly when they are about 21 days old. The male parent usually takes care of the first chick that fledges, and the female parent takes care of the rest of the chicks (Ehrlich et al.). We do not know when yellow-billed cuckoo chicks become independent from their parents. Most yellow-billed cuckoos begin breeding when they are 1 year old.

Some yellow-billed cuckoos may parasitize other birds by laying eggs in the nest of other parents. They may lay eggs in the nest of other yellow-billed cuckoos, or in the nests of other bird species, including Coccyzus erythropthalmus, Turdus americanus, Dumetella carolinensis and Hylocichla mustelina.

Breeding interval: Most populations breed once per year, though some eastern populations may lay two broods in one breeding season.

Breeding season: Yellow-billed cuckoos begin breeding in mid- to late-May

Range eggs per season: 1 to 5.

Average eggs per season: 2 to 3.

Range time to hatching: 9 to 11 days.

Range fledging age: 7 to 9 days.

Average age at sexual or reproductive maturity (female): 1 minutes.

Average age at sexual or reproductive maturity (male): 1 minutes.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 3.

Male and female yellow-billed cuckoo parents incubate the eggs, brood and feed the chicks and protect the nest from predators. They also keep the nest clean by removing the fecal sacs from the chicks. After chicks have left the nest, the parents keep feeding them until they are able to hunt for themselves.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Hughes, J. 1999. Yellow-billed cuckoo (Coccyzus americanus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 418. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coccyzus americanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATTACCCGATGACTATTCTCCACTAACCACAAAGATATCGGTACCCTATATCTTATCTTCGGTGCTTGAGCAGGCATAGTCGGCACAGCCCTAAGCCTACTCATCCGCGCAGAGCTCGGACAACCAGGAACCCTACTAGGAGACGACCAAATCTACAATGTAATTGTTACCGCACATGCCTTCGTAATAATCTTCTTCATGGTCATACCAATTATAATCGGAGGGTTCGGCAACTGACTTGTCCCTCTCATAATTGGTGCCCCAGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTCCTTCCCCCCTCCTTCCTTCTCTTACTAGCATCCTCCACAGTAGAGGCAGGAGCAGGAACTGGATGAACCGTGTACCCCCCTCTAGCTGGCAACCTAGCCCACGCCGGAGCTTCAGTAGACCTCGCCATCTTCTCCCTCCACCTAGCAGGTATTTCATCAATCCTAGGGGCAATTAATTTCATTACAACAGCCATTAACATAAAACCCCCAGCCTTATCTCAATACCAAACACCCTTATTCGTATGGTCAGTACTCATTACCGCCGTCCTACTCTTACTTTCCCTACCAGTTCTCGCTGCTGGCATTACTATATTACTAACAGATCGCAACCTAAACACCACATTCTTTGATCCCGCTGGAGGGGGCGACCCAGTACTATACAAACACCTATTCTGATTCTTCGGCCATCCAGAAGTTTACATC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coccyzus americanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5