Overview

Comprehensive Description

Summary

"A wild relative of the domestic fowl, it is found mostly in peninsular India. Usually seen foraging in mixed or single sex groups."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Peninsular India.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"General effect of the cock streaked grey, with a metallic black sickle-shaped tail. Hen distinguishable at a glance from that of the Red Jungle-fowl by her white (not rufous-brown) breast with blackish streaks."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

That of the village hen or murghi.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"Seen singly, pairs or small parties in forest and scrub jungle."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The Grey Jungle-fowl is also a denizen of forest, both deciduous and evergreen, hill and plain. It is especially partial to broken foothills country with bamboo jungle, and to the thick tangles of Lantana and secondary scrub that invariably spring up on old toungya clearings and abandoned plantations. It is usually met with singly or in pairs or small parties, though occasionally large numbers collect to feed in areas such as where bamboos or Strobilanthes are seeding. The habits of the two species are very similar, but this is perhaps even shier and more timid than the Red Jungle-fowl. When emerging into the open to feed in the mornings and evenings it seldom strays far from cover, scuttling headlong into it with outstretched neck and drooping tail on the least suspicion. Where unmolested, however, the birds become quite inured to the presence of Man, feeding in the proximity of villages and in fields under the plough. Its diet comprises of grain, shoots, and berries such as those of Lantana and Zizyphus, gleaned on the ground. It also eats termites and other insects. The crow of this Jungle-fowl has been well described as Kuck-kaya-kaya-kuck ending with a low kyukun-kyukun repeated slowly and softly and audible only at short range. It is heard principally in the early mornings — often long before daybreak—and evenings, sometimes continuing into the dark. It is uttered from the top of an ant-hill, stone or fallen log, or from the nightly roost up in a tree or bamboo clump. The crowing is usually preceded by a loud flapping of wings against the sides, and is answered one by one by all the other cocks in the neighbourhood. It is not definitely known whether this species is monogamous or otherwise."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"Eggs and young may be found practically throughout the year, but the principal laying months are from February to May. The nest and its situation are similar to those of the Red Jungle-fowl. The normal clutch is of 4 to 7 eggs, pale fawn to warm buff in colour, very like those of the domestic fowl in appearance. The hen alone incubates."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gallus sonneratii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACCAACCACAAAGACATTGGCACTCTTTACCTAATTTTCGGCACATGGGCGGGCATAGCCGGCACAGCACTTAGCCTTCTAATCCGCGCAGAACTAGGACAGCCCGGAACTCTCTTAGGAGAC---GACCAAATTTACAATGTAATCGTCACAGCCCATGCTTTCGTCATAATCTTCTTTATAGTTATACCCATCATGATCGGTGGCTTCGGAAACTGACTAGTCCCGCTTATAATCGGTGCCCCAGACATAGCATTCCCCCGCATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCATCTACCGTAGAAGCTGGGGCCGGCACAGGATGGACAGTTTACCCCCCTTTAGCCGGCAACCTAGCCCACGCTGGCGCATCAGTAGACCTAGCCATCTTTTCATTACACTTAGCAGGTGTTTCCTCCATTCTAGGAGCCATCAACTTTATCACTACCATCATCAACATAAAACCCCCCGCACTGTCACAATACCAAACACCCCTATTCGTATGATCCGTCCTCATTACTGCCATCCTACTACTCCTCTCCTTACCCGTCCTAGCAGCTGGGATTACCATACTACTTACCGACCGCAACCTTAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGTCACCCCGAAGTTTACATCCTCATCCTCCCAGGTTTCGGAATAATTTCCCACGTAGTAGCATACTATGCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTCTGAGCCATACTGTCAATCGGATTCCTTGGCTTCATTGTATGAGCCCACCATATATTCACAGTCGGAATGGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gallus sonneratii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/near threatened (LR/nt)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5