Overview

Brief Summary

Biology

Sri Lanka junglefowl roost in trees, usually singly but sometimes in pairs or family parties, and spend much of the day on the ground (3), foraging in the morning and evening along open tracks in the forest. This bird feeds on grain, weed seeds, berries, flowers, various succulent leaves and buds, and a large proportion of small animals, such as termites, beetles, woodlice, crickets and centipedes (2) (3). Animal matter forms the bulk of the diet for chicks (3). While the main breeding season is from February to May, a second clutch is often laid in August to September, and breeding appears to go on throughout the year (2) (3). Nests are constructed in a variety of locations, but typically occur on the ground amongst bushes or under logs, although use of a deserted squirrel and crows nest have been recorded, several metres above the ground. Clutches normally consist of two to four eggs, incubated for 20 to 21 days (in captivity) (2). The chicks are well developed and learn to scratch for food as soon as they leave the nest, although they will instantly scatter and hide at their mother's alarm call (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The handsome cocks of this endemic species, the national bird of Sri Lanka (3), are remarkably similar to those of domestic chickens (4). The longish plumage on the breast and upperparts is mainly a rich, fiery yellow to coppery orange with golden streaks, while the abdomen, flanks and bushy tail are a dark metallic purplish-black (2) (4) (5). The bare facial skin and two lappets hanging from the throat are red, and a fleshy red crest (comb) with central yellow patch adorns the crown (4) (5). In summer, after the main breeding season, males slowly moult and their comb shrinks in size (5). The female is much smaller than the male and has no lappets and only a tiny comb, a small purplish-black lump behind the beak (6). The hen is mostly brown with a darker tail and bold brown and buff barring on the wings (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Sri Lanka.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Native to Sri Lanka (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in a variety of habitats from coastal scrub to mountain forest, anywhere between sea level and 2,000 m (2). Although wary of man and normally not venturing far from cover, this bird will visit cultivated areas and plantations in search of food (7), and likes to frequent open places in wet weather, such as roadsides or glades, in order to feed free from drippings trees (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gallus lafayetii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTCTCAACCAACCACAAAGACATTGGCACTCTTTACCTAATTTTCGGCACATGGGCAGGCATAGCCGGCACAGCACTTAGCCTTCTAATTCGCGCAGAACTCGGACAACCCGGAACTCTCTTAGGAGACGACCAAATTTACAACGTAATCGTCACAGCCCATGCCTTCGTCATAATCTTCTTTATAGTCATACCCATCATGATCGGCGGCTTCGGAAATTGACTAGTCCCACTTATAATCGGTGCCCCAGACATAGCATTTCCCCGCATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCCTCCACCGTAGAAGCTGGGGCCGGTACAGGATGAACAGTCTACCCTCCCTTAGCCGGCAACCTAGCCCACGCTGGCGCATCAGTAGACCTAGCCATCTTTTCATTACACTTAGCCGGTGTTTCCTCCATCCTAGGAGCCATCAACTTTATCACCACCATCATCAACATAAAACCCCCCGCACTGTCACAATACCAAACACCCTTATTCGTATGATCCGTACTCATTACTGCCATCCTACTACTCCTCTCCTTACCAGTTCTAGCAGCTGGAATTACTATGTTACTTACCGACCGCAACCTTAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGCCACCCTGAAGTCTACATCCTTATTCTCCCAGGCTTTGGAATAATTTCCCATGTAGTAGCCTACTATGCAGGAAAAAAAGAACCATTCGGATACATGGGAATAGTCTGAGCCATACTCTCAATCGGATTCCTTGGCTTCATTGTATGAGCCCACCATATATTCACAGTCGGAATGGACGTAGACACCCGAGCCTACTTCACATCAGCCACAATGATCATTGCCATCCCTACTGGCATTAAAGTCTTCAGCTGACTAGCAACCCTGCACGGGGGGACAATTAAATGGGATCCCCCTATACTATGAGCCCTGGGGTTCATCTTCCTCTTCACTATCGGAGGCCTAACGGGAATCGTCCTTGCTAACTCATCACTAGATATTGCCCTTCATGACACCTACTATGTAGTCGCCCACTTCCACTATGTCCTCTCAATGGGGGCAGTTTTTGCCATTCTAGCAGGATTTACCCACTGATTTCCCCTCTTCACAGGCTTTACCCTACACCCATCATGAACCAAGGCACATTTCGGAGTAATATTTACCGGAGTTAACCTAACCTTTTTCCCCCAACATTTCCTGGGCCTAGCTGGAATACCCCGACGATACTCAGATTACCCAGACGCCTACACACTATGAAACACACTATCCTCAATCGGCTCCTTAATTTCAATAACAGCCGTAATCATACTCATATTCATCGTCTGAGAAGCCTTCTCAGCAAAACGAAAAGTACTCCAACCCGAATTAACTGCCACTAATATCGAATGAATTCATGGCTGCCCACCCCCATACCACACCTTCGAAGAACCAGCCTTTGTACAAGTGCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gallus lafayetii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a restricted range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5