Articles on this page are available in 3 other languages: Chinese (Simplified) (6), Dutch (1), Spanish (12) (learn more)

Overview

Brief Summary

Asio flammeus

The small tufts of feathers on its forehead give the Short-eared Owl its name. Like all birds, however, the Short-eared Owl’s real ears are small openings hidden underneath the feathers on the sides of its head. This species possesses the short legs, rounded wings, large yellow eyes, and disk-shaped face characteristic of owls. The Short-eared Owl may also be identified by its size (15 inches), streaked brown-and-tan body, and off-white face. Males and females are similar at all seasons. The Short-eared Owl occurs across much of the world, being absent only from polar regions, isolated oceanic islands, and Australia. In North America, the Short-eared Owl breeds across Canada, Alaska, and the northern tier of the United States. Populations breeding in colder regions migrate south for the winter, while warmer parts of the Short-eared Owl’s breeding range host this species all year. In winter, Short-eared Owls may be found across much of the United States and south to central Mexico. Short-eared Owls breed primarily in open, treeless habitats such as tundra, grassland, and prairie. This species also frequents open habitats in winter, when it may be found in fields and marshes. Typical for an owl, the Short-eared Owl eats small mammals, such as mice, voles, and shrews, and may be found in greater numbers where prey is plentiful. The Short-eared Owl is an adept night hunter, using its excellent hearing to locate prey on the ground in order to fly down and capture it with its talons. However, like some other owls, this species frequently hunts during the day as well. This fact, combined with the Short-eared Owl’s preference for open habitat, makes this a comparatively easy owl species to observe.

  • Asio flammeus. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012.
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Short-eared Owl (Asio flammeus). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012.
  • Wiggins, D. A., D. W. Holt and S. M. Leasure. 2006. Short-eared Owl (Asio flammeus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/062
  • eBird Range Map - Short-eared Owl. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012.
translation missing: en.license_cc_by_nc_sa_4_0

© Smithsonian Institution

Supplier: Robert Costello

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unlike most owls, you see short-eared owls flying also during the day. Their flame-colored plumage is easy to recognize in daylight. It's no coincidence that their Latin name describes this feature (flammeus). Short-eared owls are the only species of owls in the Netherlands that build their own nest. It's no more than a hollow, lined with grass and hidden in the vegetation. During years with lots of voles, these owls will lay as many as a dozen eggs. They protect their nests from predators using the cripple-wing technique: pretend to make an easy prey by walking around with a 'wounded' wing, thusly fooling the intruder and taking its attention away from the nest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A skilled hunter, the short-eared owl is most active during the morning, late afternoon and night, when it can be seen flying low above the ground searching for prey (2) (4). The structure of the wings and feathers give this species impressive aerial agility, and make its flight almost entirely silent. This is a very useful adaptation, as this species mainly hunts by sound, and also means that prey are not alerted to its presence. The short-eared owl feeds upon small mammals up to the size of hares, but will also take birds. Feeding is a rather gruesome affair, and involves the owl decapitating its prey, before pulling out the entrails, or, in the case of birds, pulling off the wings and swallowing them whole (2). In order to attract a mate, the male short-eared owl carries out a dramatic aerial display, involving rising quickly, hovering and descending with exaggerated wing beats, along with singing and wing-clapping (2) (4). Breeding pairs generally remain together for a single breeding season, although it is possible that breeding with multiple partners may also occur. Egg-laying takes place between March and June in the northern hemisphere, while in the southern hemisphere it commences in September. The female constructs a nest comprising a scraped out bowl in the ground lined with grasses and downy feathers. A clutch of between 5 and 10 eggs is laid and incubated by the female for 26 to 29 days, while the male brings food and defends the nest. At 12 to 18 days after hatching the young leave the nest, but are unable to fly and so hide in vegetation. This behaviour serves to minimise time spent in the nest, where predation is most likely to occur. The short-eared owl reaches sexual maturity at 1 year or less and may live for around 13 years (2). Although in the southern parts of its range the short-eared owl generally remains in the same location throughout the year, northern populations are highly migratory and make long-distance journeys to find food. Interestingly, if this species finds a wintering area with an abundant food supply it may remain there permanently (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The short-eared owl's scientific name flammeus, meaning “fiery”, is a reference to its boldly streaked plumage, which provides excellent camouflage when concealed amongst vegetation (4). This species has a large round head, with a white-bordered facial disc, and striking yellow eyes framed with black. The plumage is mostly mottled brown and buff on the upperparts, with black bars on the wings and tail feathers, while the breast is whitish or pale buff, with dense vertical streaking. The underwing is buffish-white, with a black tip, and a distinctive ochre patch just beyond the mid-wing, on the leading edge. The female short-eared owl is slightly larger than the male, with heavier streaking and browner upperparts, while the juvenile is darker still, with a brownish-black facial disc. There are ten recognised subspecies of short-eared owl, which vary in terms of location and colouration. Perhaps the most distinctive of these subspecies is Asio flammeus galapagoensis, which has extremely dark plumage and larger black regions around the eyes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur : 34 à 42 cm, envergure : 95 à 107 cm, poids : 300 à 430 g pour les mâles et entre 350 et 500 g pour les femelles.

Le Hibou des marais ressemble au Hibou moyen-duc mais ses aigrettes sont très courtes, à peine visibles. Il est caractérisé par un iris jaune soufre et un cercle noir autour des yeux qui contraste avec le fond pâle de la face. A noter aussi le dessous uniquement rayé, sans vermiculures transversales sombres. Le plumage a une couleur de fond jaune roseau sec. Le dessus est grossièrement tacheté de brun-foncé. Les pieds et les doigts sont emplumés jusqu’au bout des ongles noirs. En vol, on remarque les longues ailes étroites pâles en dessous avec les extrémités noires et un arc de la même couleur au poignet. Le dessus des ailes comporte un bord de fuite blanc bien visible.

Le Hibou des marais est partiellement diurne en France. En période de reproduction, l’activité diurne peut représenter jusqu’à 65 % du cycle circadien des oiseaux et en hiver, il est très courant d’observer un Hibou des marais chassant en plein jour.

Le Hibou des marais pratique surtout la chasse en vol et peu la chasse à l’affut (simplement par mauvais temps ou en cas de neige au sol). Le vol du Hibou des marais est chaloupé, entre 50 cm et 2 m du sol ; il s’agit d’un vol très lent, entrecoupé de planés et de surplace. Le Hibou des marais se nourrit essentiellement de campagnols et plus précisément de Campagnol des champs et Campagnol agreste. En cas de pénurie, il peut se rabattre sur des petits oiseaux ou sur d’autres rongeurs. Ses pelotes de réjection mesurent en moyenne 48 mm de long et 22 mm de diamètre.

Les Hiboux des marais affichent un comportement très territorial. Même dans un couple, les congénères ne recherchent pas de contacts étroits et se reposent seuls. Les couples ne se forment que saisonnièrement et les oiseaux sont peu fidèles.

Vers douze jours, les poussins commencent à sortir du nid et à se disperser dans les environs ; les parents continuent à leur apporter des proies. Les jeunes sont très mobiles mais il reste à proximité du nid, sous le couvert végétal. L’éclatement de la famille survient habituellement quand les oiseaux quittent le territoire de nidification en automne. Des leur émancipation, les jeunes Hiboux des marais migrent très loin, parfois à plusieurs centaines de kilomètres de distance.

Le Hibou des marais vit dans des milieux ouverts à végétation basse mais offrant un couvert suffisant. L’espèce recherche les milieux humides, on la retrouve ainsi dans les landes, friches et prairies humides, marais et tourbières, zones d’envasement, zones dunaires, marécages. Toutefois, le Hibou des marais peut aussi nicher en milieux secs et herbeux, landes sèches et steppes et à l’occasion dans des coupes et clairières ou des jeunes plantations de conifères, voire champs de céréales.
Le Hibou des marais établit un nid rudimentaire à terre. La taille d’un territoire de chasse peut aller jusqu’à 2 km autour du nid et le domaine vital varie de 15 à une centaine d’hectare en fonction des régions et au cours de l’année.

En France, le Hibou des marais niche dans certaines régions mais il est surtout hivernant. Des individus en nombre arrivent depuis les pays du Nord et se rassemblent en dortoirs de plusieurs dizaines d’individus.

Manifestation vocale : Voix relativement douce, étouffée et sourde qui ne porte pas très loin. Chant territorial du mâle composé de 10 à 20 bouh simples, bien détachés et débités rapidement.

Pour en savoir plus : MEBS T. & SCHERZINGER W. (2006). Rapaces nocturnes de France et d’Europe. Les encyclopédies du naturaliste. Éditions Delachaux & Niestlé. 398 pages.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Short-eared owls are one of the world's most widely distributed owls. They inhabit all of North and South America; this area includes the coast of the Arctic Ocean to Pantagonia. Short-eared owls can also be found on every continent except Australia and Antarctica. (Granlund et al., 1994; Welty, 1975; Pearson, 1936)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The breeding range in North America extends from northern Alaska to northern Labrador, south to California, Utah, Colorado, Missouri, Illinois, Ohio, and Virginia. The species breeds in small numbers in every province and territory in Canada (Cadman and Page 1994). It is more numerous in western and central North America than in eastern North America. In the northeastern United States, it currently nests in Vermont, New York, Massachusetts, and Pennsylvania (Tate 1992). In Eurasia the sort-eared owl ranges from Iceland, British Isles, Scandinavia, northern Russia, and northern Siberia south to southern Europe, Afghanistan, northern Mongolia, the northern Kurile Islands, and Kamchatka. The species also occurs in the Hawaiian Islands, Caroline Islands (Ponape), and Greater Antilles (Cuba, Hispaniola, Puerto Rico) (AOU 1983). During the nonbreeding season, this owl occurs mostly in the southern parts of most Canadian provinces and southward to southern Baja California, southern Mexico, the Gulf Coast, and Florida; also Hawaii (resident on all main islands) and the Greater Antilles (uncommon in Puerto Rico, including Isla Culebra). In the Old World, nonbreeding occurrences extend from the breeding range south to northwestern Africa, Mediterranean region, Ceylon, southern China, and Japan (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Short-eared owls are one of the world's most widely distributed owls. They inhabit all of North and South America; this area includes the coast of the Arctic Ocean to Pantagonia. Short-eared owls can also be found on every continent except Australia and Antarctica. (Granlund et al., 1994; Welty, 1975; Pearson, 1936)

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The short-eared owl occurs on all continents except Australia and
Antarctica [5,12,28]. In North America, it is distributed from Alaska
and all Canadian provinces except the Northwest Territories south
through the conterminous United States to central Mexico. It also
occurs on Pacific and Caribbean islands including Hawaii, Puerto Rico,
and the Virgin Islands [12,22,23,28].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY
DC PR VI
AB BC MB NB NF NS ON PE PQ
SK YT MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

One of the most widespread owl species, the short-eared owl's range extends throughout the Americas, Europe and Asia (5). Subspecies Asio flammeus flammeus has the widest distribution and is known to breed in Iceland, the British Isles and much of Europe and Asia, as far east as the Kamchatka Peninsula and the Commander Islands, and south as far as Spain and north-east China. This subspecies is also found in North America from western and northern Alaska, east through Canada and south to central USA. The other subspecies have smaller ranges: Asio flammeus ponapensis occurs on Pohnpei Island in the East Caroline Island Group; Asio flammeus sandwichenis inhabits several Hawaiian Islands; Asio flammeus domingensis occupiesHispaniola and Cuba; Asio flammeus portoricensis is found on Puerto Rico; Asio flammeus pallidicaudus inhabitsnorthern Venezuela and Guyana; Asio flammeus bogotensis occurs in Colombia, Ecuador and north-west Peru; Asio flammeus galapagoensis is only found on theGalapagos Islands; Asio flammeus suinda inhabits southern Peru, western-central Bolivia, Paraguay, south-east Brazil, south to Tierra del Fuego; and Asio flammeus sanfordi is restricted to the Falkland Islands (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Short-eared owls range in length from 340 to 415 mm in males (mean 373 mm) and 340 to 423 mm in females (mean 382 mm). Wing length is from 279 to 307 mm in males and 267 to 314 mm in females. Wingspan is estimated at 950 to 1100 mm. Males and females are not easily distinguishable from each other externally, but females are usually slightly larger. Their feathers are yellow-white and dark brown; parts of the head and especially the legs and flanks are white. Individuals vary considerably in colors. The right and left ears occupy different vertical positions on the sides of their head, but the size and shape of the two ears are the same. (Holt and Leasure, 1993; Martin, 1990; Pearson, 1936)

Range mass: 206 to 475 g.

Average mass: 347 g.

Range length: 340 to 423 mm.

Range wingspan: 950 to 1100 mm.

Average basal metabolic rate: 313.375 cm3.O2/g/hr.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Short-eared owls are 340 to 423 mm long and have a wing length of 279 to 314 mm. Males and females are not easy to tell apart just by looking at them, but females are usually slightly larger. Their feathers are yellow-white and dark brown; parts of the head and especially the legs and flanks are white. Individuals vary considerably in colors. The right and left ears are positioned differently on the sides of their head, but the size and shape of the two ears are the same. (Holt and Leasure, 1993; Martin, 1990; Pearson, 1936)

Range mass: 206 to 475 g.

Average mass: 347 g.

Range length: 340 to 423 mm.

Range wingspan: 950 to 1100 mm.

Average basal metabolic rate: 313.375 cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 38 cm

Weight: 378 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

These are probably the most diurnal of owls (Lockie 1955, Clark 1975) and may often be observed from late afternoon until nightfall, or at dawn. A crow-sized owl abroad during daylight in open country will most likely be a short-eared owl. However, they also hunt at night. Easily recognized by its blunt-headed profile and the fact that it glides with its wings held horizontally. This contrasts with the shallow V-shape of the northern harrier (Circus cyaneus) with which the owl often shares habitat and may be confused. Harriers may also be distinguished by their white rump patch. Habitat is useful in separating short-eared owls from long-eared owls (Asio otis), the latter being predominantly a woodland dweller. The long-eared owl is also more slender with much longer ear tufts. Burrowing owl also inhabits open country but is smaller (24 cm vs. 38 cm), has relatively longer legs, and (in adults) has at least some horizontal barring on the breast. The short-eared owl's style of flight is unique and has at times been called mechanical, moth-like, or even "slovenly" (Peterson 1934).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.458 - 13.104
  Nitrate (umol/L): 2.286 - 8.894
  Salinity (PPS): 31.635 - 35.399
  Oxygen (ml/l): 6.089 - 6.746
  Phosphate (umol/l): 0.273 - 0.577
  Silicate (umol/l): 1.963 - 5.972

Graphical representation

Temperature range (°C): 9.458 - 13.104

Nitrate (umol/L): 2.286 - 8.894

Salinity (PPS): 31.635 - 35.399

Oxygen (ml/l): 6.089 - 6.746

Phosphate (umol/l): 0.273 - 0.577

Silicate (umol/l): 1.963 - 5.972
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

One of the world's most widely distributed owls, Asio flammeus can be found throughout much of North America and Eurasia. These owls prefer to live in marshes and bogs; they inhabit open, treeless areas. Their hunting and nesting habits make them well suited to relatively flat land. This species is migratory but uses relatively similar habitats during summer and winter. Short-eared owls have specialized eating habits and tend to stay where they can find ample food. They will leave an area to find preferred prey rather than eat other animals. Nests are usually located on dry sites and in open country supporting small mammals such as voles and lemmings.

(Martin, 1990; Sparks and Soper, 1989; Pearson, 1936)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: marsh ; swamp ; bog

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Broad expanses of open land with low vegetation for nesting and foraging are required. Habitat types frequently mentioned as suitable include fresh and saltwater marshes, bogs, dunes, prairies, grassy plains, old fields, tundra, moorlands, river valleys, meadows, savanna, open woodland, and heathland (Dement'ev et al. 1951, Clark 1975, Mikkola 1983, Holt and Melvin 1986). In general, any area that is large enough, has low vegetation with some dry upland for nesting, and that supports suitable prey may be considered potential breeding habitat, although many will not have breeding short-eared owls. Dement'ev and Gladkov (1951) assert that "nearby water" is a requirement for nesting habitat. Roosts by day on ground, on low open perch, under low shrub, or in conifer. Reported from "forest" habitats in Hawaii.

Nests on ground, generally in slight depression (Terres 1980), often beside or beneath a bush or clump of grass. Many nests are near water but generally are on dry sites. In coastal Massachusetts, nested in secondary herbaceous grass/sand dune vegetation dominated by Ammophila (Holt 1992). Same nest site may be used in successive years. Moves into and breeds in areas with high rodent densities.

Generally nest on high ground or upland sites (Pitelka et al. 1955; Clark 1975; Holt and Melvin 1986; Tate and Melvin 1987, 1988; Combs and Melvin 1989). Urner (1925) reported nests in a saltmarsh, one of which was subsequently flooded by a high tide, but in general, drier sites are preferred. During five years of study on Nantucket and Tuckernuck islands, all 41 nests found were in dry upland areas, though wetter sites were available (Holt and Melvin 1986; Tate and Melvin 1987, 1988; Combs and Melvin 1989; Combs and Griffin 1990). Eight nest sites at Monomoy National Wildlife Refuge, east of Nantucket, found between 1982 and 1985, were also all on dry upland sites (Holt and Melvin 1986).

Using a line-intercept technique (Brower and Zar 1977, Holt and Melvin 1986), vegetation characteristics of 15 nest sites on Nantucket were evaluated in 1986 and 1987. This analysis showed that low dense shrubs, mainly black huckleberry (Gaylussacia baccata) and bayberry (Myrica pennsylvanica), that were less than 0.5 m comprised 40.4%, and high dense shrubs (same species, >= 0.5 m) comprised 37.14% of the cover within five meters of the nest (Tate and Melvin 1987, 1988). Other vegetation included low sparse shrubs (11.1%), low dense grass (8.1%), and high dense grass (3.0%, mostly Andropogon scoparius and Ammophila breviligulata). These data demonstrate that in choosing nest sites on Nantucket, dense shrub cover is usually sought.

NON-BREEDING: Suitable breeding habitat may also be occupied by wintering birds. Conversely, Clark (1975) noted two occasions when winter territories became breeding territories. Short-eared owls tend to congregate and roost communally in the winter (Banfield 1947, Craighead and Craighead 1956, Clark 1975), often in sheltered sites near hunting areas. Winter roosts have been reported in abandoned dumps, quarries, gravel pits, storage yards, stump piles, old fields, small evergreen groves, bayberry thickets, dunes, and open, abandoned cellars (Clark 1975, Bosakowski 1986). May also roost directly on the ground in tall grasses, possibly choosing vegetation of a coloration that blends with their plumage (Craighead and Craighead 1956).

In winter the ground roosting habit may be abandoned for trees, possibly in response to deep snow (Banfield 1947, Bosakowski 1986). Smith (1989) noted drastic decreases in numbers of short- eared owls at known winter roosts on Point Peninsula in Jefferson County, New York, after a heavy snowfall created deep cover.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

One of the world's most widely distributed owls, short eared owls can be found throughout much of North America and Eurasia. These owls prefer to live in marshes and bogs; they inhabit open, treeless areas. Their hunting and nesting habits make them well suited to relatively flat land. This species is migratory but uses relatively similar habitats during summer and winter. Short-eared owls have specialized eating habits and tend to stay where they can find ample food. They will leave an area to find preferred prey rather than eat other animals. Nests are usually located on dry sites and in open country supporting small mammals such as voles and lemmings.

(Martin, 1990; Sparks and Soper, 1989; Pearson, 1936)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: marsh ; swamp ; bog

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the term: cover

Nesting cover - Short-eared owl require open areas with dense, tall
herbs for nesting. They are the only North American owl that habitually
build their own nest each year. Nesting short-eared owl build the nest
with sticks and rotting vegetation; they approach it through a short
tunnel in the thick grass [28]. Duebbert and Lokemoen [15] found that
in North Dakota rangeland planted to smooth brome (Bromus inermis),
intermediate wheatgrass (Thinopyrum intermedium), and tall wheatgrass
(Elytrigia elongata), owls selected sites where grass cover was 12 to 24
inches (30-60 cm) tall. Seventy-five percent of nests were
three-fourths concealed from the sides; tops were mostly open. Evrard
and others [18] found that in a Wisconsin old field, nesting cover was
mostly 3-foot (90-cm) quackgrass (Elytrigia repens).

Hunting cover - Short-eared owl require open landscapes for hunting.
They generally hunt on the wing, flying low [28], but occasionally hunt
from low perches such as saplings and fenceposts [7].

Roosting cover - Short-eared owl usually roost on the ground or on grass
tussocks, although they occasionally use low brush [28], fenceposts, and
telephone poles [9]. During winter in snow country, they often roost
communally in low-growing conifers [12,28,33,39]. Observers in New
Jersey saw short-eared owl flocking together and roosting in short
conifers whenever snow cover was greater than 30 inches (75 cm) [9].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, heath, marsh, taiga, tundra

Short-eared owl occupy a variety of open habitats within their wide
geographical distribution. Preferred habitats include fresh- and
saltwater marshes [6,7,12,21], coastal plains [24], tamarack (Larix
laricina)-black spruce (Picea mariana) bogs [8], old fields [14,18],
prairies [30], sagebrush (Artemisia spp.) steppes [38,40,42], wet
meadows, grasslands, open shrublands, and montane parklands [21,22].

Since the species is only weakly migratory, nesting, hunting, and
wintering habitats are generally the same [12,28]. In Massachusetts,
short-eared owl in maritime heath occupied a home range of 63 to 198
acres (25-79 ha) [45]. In freshwater marsh, the home range was 184.8 to
303.5 acres (73.9-121.4 ha) [12].

Nesting habitat - Short-eared owl nest on dry ground in open areas with
dense herbaceous cover. Even in wetlands, dry microsites are selected
for nesting [13]. Taiga and tundra are poor nesting habitat [12].

Hunting habitat - The owl uses open ground where prey is available [7,33].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the terms: taiga, tundra

The short-eared owl occurs in most open plant communities in North
America [12,13,21,22,28]. Taiga is usually used only in late summer
[12]. The owl avoids tundra and closed-canopy brushland and forest
[12,21,22,32].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: cactus, shrub

K022 Great Basin pine forest
K030 California oakwoods
K042 Creosotebush - bursage
K043 Paloverde - cactus shrub
K048 California steppe
K049 Tule marshes
K051 Wheatgrass - bluegrass
K052 Alpine meadows and barren
K053 Grama - galleta steppe
K054 Grama - tobosa prairie
K055 Sagebrush steppe
K056 Wheatgrass - needlegrass shrubsteppe
K057 Galleta - three-awn shrubsteppe
K058 Grama - tobosa shrubsteppe
K061 Mesquite - acacia savanna
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K065 Grama - buffalograss
K066 Wheatgrass - needlegrass
K073 Northern cordgrass prairie
K074 Bluestem prairie
K077 Bluestem - sacahuista prairie
K079 Palmetto prairie
K080 Marl - everglades
K088 Fayette prairie
K092 Everglades
K093 Great Lakes spruce - fir forest
K094 Conifer bog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES26 Lodgepole pine
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

13 Black spruce - tamarack
37 Northern white-cedar
38 Tamarack
68 Mesquite
209 Bristlecone pine
242 Mesquite
250 Blue oak - Digger pine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.458 - 13.104
  Nitrate (umol/L): 2.286 - 8.894
  Salinity (PPS): 31.635 - 35.399
  Oxygen (ml/l): 6.089 - 6.746
  Phosphate (umol/l): 0.273 - 0.577
  Silicate (umol/l): 1.963 - 5.972

Graphical representation

Temperature range (°C): 9.458 - 13.104

Nitrate (umol/L): 2.286 - 8.894

Salinity (PPS): 31.635 - 35.399

Oxygen (ml/l): 6.089 - 6.746

Phosphate (umol/l): 0.273 - 0.577

Silicate (umol/l): 1.963 - 5.972
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The short-eared owl is mostly found in open country, occupying tundra, marshland, grassland, savanna, sand dunes and moorland from sea level to elevations as high as 4,000 metres in the Andes (2). It requires sufficient vegetation to provide cover for nesting, as well as an abundance of small mammal prey (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations throughout most of Canada and north-central U.S. move south for winter. Somewhat nomadic. Arrives in northern breeding areas mid-May to early June (Johnson and Herter 1989). Migrational patterns are not well known. Apparently more northerly parts of the range are vacated in the fall and the owls move southward (Craighead and Craighead 1956, Clark 1975). In North America the movement is mostly from Canada and Alaska as far south as the southern U.S. and even Mexico (Cramp 1985). Toward the central part of the species' range (temperate zones) owls are seen year-round. Because breeding birds move south in fall and winter and are replaced by migrants from more northerly areas, Clark (1975) suggests that separate populations may occupy these areas during the different seasons.

It is also possible that the owl migrates only in search of food and therefore may remain year-round in an area that provides sufficient resources. The owl congregates in areas where prey is plentiful (Bent 1938, Mikkola 1983) and may migrate accordingly. This feature of the biology has earned it a reputation as an "irregular migrant," or as "nomadic," "irruptive," or "vagrant" (Clark 1975, Mikkola 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Short-eared owls prey primarily on voles, mice, and other small mammals. Their strong talons and sharp beak make them well adapted to 'picking up' their food while in flight. These owls may utilize a 'perch-and-pounce' hunting method if there is an adequate perching point available. Otherwise, they hunt by flying two meters above the ground in a regular, slow manner. Short-eared owls rely mainly on auditory clues; using these alone, they can catch prey that is under continuous grass cover. (Martin, 1990 and Pearson, 1936)

Animal Foods: birds; mammals

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly rodents (commonly Microtus); also regularly other small mammals, small birds (especially in coastal areas), and insects (Terres 1980, Holt 1993a, Holt 1993b). Forages primarily by flying low, typically into wind, and dropping down onto prey, sometimes after brief hover. Sibling cannibalism may occur. Sometimes caches food. Prey is small mammals and some small birds; unfledged young may also take some insects. The preferred prey is often reported as microtine rodents (Goddard 1935, Lockie 1955, Mikkola 1983). Clark (1975) reported meadow voles (Microtus pennsylvanicus) in ? 91% of pellets analyzed from a winter roost in New York between 1967 and 1970. Pitelka et al. (1955) found that short-eared owls breeding in Barrow, Alaska, fed solely on brown lemmings (Lemmus sibiricus). Mikkola (1983) summarized studies of prey items taken in the breeding season in Finland, Norway, Germany, and Hungary and found that voles (Microtus spp.) made up 78.9%, 65.1%, 94.6%, and 21.1% of the diet respectively. In Hungary, shrews (Soricidae) predominated in 69.9% of the diet while in Finland and Norway, voles (Clethrionomys spp.) and shrews accounted for most of the other identifiable prey items. Two voles, Microtus agrestis and M. arvalis, comprised 98% of all prey species in a Finnish study in 1977 (Korpimaki 1984).

On Nantucket Island, seven species of small mammals were identified from prey remains in 1,992 short-eared owl pellets collected over two years (1986-87), predominately during the spring and summer (Tate 1991). Of these, meadow voles (M. pennsylvanicus) were the most abundant, accounting for 89% of prey items. Short- tailed shrews (Blarina brevicauda) and white-footed mice (Peromyscus leucopus) each comprised 3% of the total, with birds and insects making up 2.5% and 1.0%, respectively. Analysis of 1,214 pellets collected on Nantucket in 1985 showed that meadow voles comprised 93.3% of total prey remains (Holt and Melvin 1986).

Short-eared owls are attracted to areas with abundant food resources, and may breed opportunistically and sporadically in such areas. When they do find areas of especially abundant resources they may breed in large numbers (Pitelka et al. 1955, Beske and Champion 1971, Larsen 1987) and produce super-normal clutches (Adair 1982, Goddard 1935).

Short-eared owls hunt predominantly by flying low over open areas in coursing flights much like those of northern harriers. Upon detecting prey the owl drops or pounces, sometimes briefly hovering beforehand. They may also hunt from a perch and dive directly on prey. At times they also hunt using a hovering flight similar to American kestrels (Falco sparverius). They hang in the air for protracted periods of time at considerable heights until prey is sighted. As Clark (1975) notes, this protracted hovering has often been reported in the European literature but has been seldom mentioned for North American birds. On Nantucket, they were most often observed hunting in this fashion over dunes of grasses (Ammophila breviligulata) (G. Tate, pers. obs.).

During the breeding season, food is sometimes cached (Young et al. 1988). On Nantucket Island three separate owls were observed caching food on four separate occasions. Each cache involved meadow voles that were taken short distances from the site of capture and placed beneath small shrubs. Each owl then resumed hunting (Tate 1991). Short-eared owls were observed caching food in Jefferson County, New York, during a winter when food resources appeared abundant (G. A. Smith, pers. comm.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Short-eared owls prey primarily on voles, mice, and other small mammals. Their strong talons and sharp beak make them well adapted to 'picking up' their food while in flight. These owls may utilize a 'perch-and-pounce' hunting method if there is an adequate perching point available. Otherwise, they hunt by flying two meters above the ground in a regular, slow manner. Short-eared owls rely mainly on auditory clues; using these alone, they can catch prey that is under continuous grass cover. (Martin, 1990 and Pearson, 1936)

Animal Foods: birds; mammals

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Unlike most owls, short-eared owl hunt both day and at night until
sufficient prey are taken [12,28]. Throughout most of North America,
the meadow vole (Microtus pennsylvanicus) is selectively hunted and
comprises at least 90 percent of the short-eared owl's diet
[5,12,14,26,28]. Clark [12] speculated that on this continent,
short-eared owl cannot reproduce unless sufficient meadow vole are
taken. Current knowledge of short-eared owl food habits and nutritional
requirements is insufficient to determine whether this is true, however
[50]. Minor items in the short-eared owl diet include other voles
(Microtus spp.), deer mouse (Peromyscus maniculatus), shrews
(Soricidae), and small birds [9,46,48]. In Hawaii, the house mouse (Mus
musculus) and the Polynesian rat (Rattus exulans) are primary prey
[22,42].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Short-eared owls are important predators on populations of many different types of small mammals and birds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Short-eared owls are vulnerable primarily to mammalian predation due to the type of open habitat they occupy and their ground nesting habit. Short-eared owls fly fast and directly at an intruder, pulling up and presenting their talons at the last moment. They often use thermal updrafts during skirmishes and rise vertically, chasing and interacting with intruders. They may scream, whine, and distract predators on eggs or nestlings by pretending to have a broken wing.

Known Predators:

  • northern goshawks (Accipiter gentilis)
  • peregrine falcons (Falco peregrinus)
  • gyrfalcons (Falco rusticolus)
  • red-tailed hawks (Buteo jamaicensis)
  • great horned owls (Bubo virginianus)
  • snowy owls (Nyctea scandiaca)
  • bald eagles (Haliaeetus leucocephalus)
  • northern harriers (Circus cyaneus)
  • common ravens (Corvus corax)
  • herring gulls (Larus argentatus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Short-eared owls are important predators on populations of many different types of small mammals and birds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Short-eared owls are vulnerable primarily to mammalian predation due to the type of open habitat they occupy and their ground nesting habit. Short-eared owls fly fast and directly at an intruder, pulling up and presenting their talons at the last moment. They often use thermal updrafts during skirmishes and rise vertically, chasing and interacting with intruders. They may scream, whine, and distract predators on eggs or nestlings by pretending to have a broken wing.

Known Predators:

  • northern goshawks (Accipiter_gentilis)
  • peregrine falcons (Falco_peregrinus)
  • gyrfalcons (Falco_rusticolus)
  • red-tailed hawks (Buteo_jamaicensis)
  • great horned owls (Bubo_virginianus)
  • snowy owls (Nyctea_scandiaca)
  • bald eagles (Haliaeetus_leucocephalus)
  • northern harriers (Circus_cyaneus)
  • common ravens (Corvus_corax)
  • herring gulls (Larus_argentatus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Large avian predators such as great horned owl (Bubo virginianus) [4],
snowy owl (Nyctea scandiaca) [33], and rough-legged hawk (Buteo lagopus)
[36] occasionally prey upon both juvenile and adult short-eared owl.
Ground-nest predators such as American badger (Taxidea taxus) [47] and
gulls (Larus spp.) [12] eat the eggs.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Asio flammeus is prey of:
Accipiter gentilis
Buteo jamaicensis
Haliaeetus leucocephalus
Circus cyaneus
Falco rusticolus
Falco peregrinus
Larus argentatus
Bubo virginianus
Nyctea scandiaca
Corvus corax

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Asio flammeus preys on:
Aves
Mammalia
Spermophilus washingtoni
Microtus longicaudus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but undoubtedly exceeds 10,000. In the mid-1980s, estimated number of breeding pairs in the northeastern U.S. was less than 55 (see Tate [1992] for information on status in particular states). Estimated number of breeding pairs in Canada in the early 1990s was 20,000-40,000 (Kirk et al. 1995). Estimates from other regions are unknown. Analysis of North American Breeding Bird Survey (BBS) data for 1966-2003 resulted in average observed abundances of 0.18 birds/route survey-wide, 0.13 birds/route in Canada, and 0.2 birds/route in the U.S. for this species (Sauer et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Somewhat gregarious in winter; groups may gather where prey is abundant (NGS 1983, Tate 1992). Breeding density in different areas 0.6-6 pairs per sq km. May defend feeding territory in winter (where prey is sufficient). Reported average home range size: 15-200 ha. In coastal Massachusetts, 10 territories averaged 64 ha (48-126 ha) (Holt 1992). In Manitoba, mean size of five territories was 73.9 hectares (Clark 1975).

Local abundance varies with vole abundance. In the winter, short-eared owls congregate at sites that provide good foraging (Craighead and Craighead 1956). Congregations of up to 200 birds have been reported (Bent 1938). Assemblage sites usually provide shelter and are within, or adjacent to, hunting areas (Clark 1975). In wintering areas in New York where vole densities were high, Clark (1975) saw owls establish and defend hunting territories. Territories were less distinct when vole numbers were low.

DISEASES, PARASITES, AND PREDATION: Disease is presently not known to limit populations. Harrison (1943) reported an owl infected with Mycobacterium tuberculosis avium In 1987, four young owls from two widely separated nests on Nantucket Island were discovered to be suffering from a feather disorder of unknown cause (Tate 1991), in which the juvenal plumage was not developing properly and the emerging feathers were twisted or malformed. All of these young had developed open sores, apparently from picking at the skin around these feather shafts with their beaks. This problem is not known to have been reported previously in the literature and no cause was determined. Avian predation is known from: great horned owl (Bubo virginianus), snowy owl (Nyctea scandiaca), peregrine falcon (Falco peregrinus), and marsh harrier (Circus aeruginosus) (Clark 1975). Northern harrier, American crow (Corvus brachyrhynchos), and European kestrel (Falco tinnunculus) have been known to steal prey from short-eared owls (Village 1987, Tate 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: fire suppression, succession

Fire was historically an important disturbance in many of the plant
communities short-eared owl occupy. It created grass patches within
shrublands, maintained the open structure of parklands, and prevented
woody plant invasion of marshlands and grasslands. Although much of
short-eared owl decline can be attributed to urbanization, at least some
is probably due to succession of open plant communities to closed ones
as a result of fire suppression. Expansion of eastern deciduous species
into prairie, for example, has reduced short-eared owl habitat [32].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: heath, marsh, taiga

Age at sexual maturity - 1 year [27]

Courtship and breeding - Short-eared owl form pair bonds; whether the
pairing lasts past the breeding season is unknown [27]. Depending upon
latitude, courtship begins in mid-winter or early spring, and breeding
is completed by late winter or late spring. In Idaho and Massachusetts,
courtship begins in March and the female lays eggs by May [2,24]. In
Illinois, courtship begins in late April and egg-laying is complete by
early May [28].

Nesting and incubation - Most North American populations are
single-brooded, although short-eared owls in the South are sometimes
double-brooded. Clutch size varies from 2 to 14 eggs, with 5 to 7 eggs
being the norm [28]. The female tends to lay more eggs when prey
populations are high [13]. Murray [37] found that clutch sizes were
significantly larger with increasing latitude; he attributed this to
larger rodent populations in the North. The female lays her eggs
asynchronously, from 2 to 7 days apart. Regional egg-laying dates are
given below [28].

Alaska and arctic Canada: June 5-July 2; usually June 10-June 25
southern Canada: April 30-June 22; usually May 4-June 17
northern United States: April 14-June 15; usually April 23-June 10
Midwest: April 4-June 8; usually April 16-May 25
southern California: March 20-May 18; usually March 26-April 26

Destroyed clutches are usually replaced within 2 weeks; second clutch
sizes are smaller [12,28].

The female is the sole incubator; the male supplies her with food during
incubation. Incubation time is 21 to 29 days per egg. The eggs hatch
asynchronously, about one every 3 days. The brood therefore consists of
different-aged sibs. The female does all brooding; the male hunts to
feed the young and his mate [12,16,24,28].

Fledging - Young leave the nest on foot about 16 days after hatching and
fledge at approximately 29 days of age [24,25]. The brood is dependent
on the parents for food "for a period of time" after fledging [13].
After all young have fledged, parents lead the brood to a new area if
prey is scarce on the nesting grounds [34].

Clark [12] reported a mean clutch size of 8.6 for short-eared owl nests
in a Massachusetts freshwater marsh. An average of 7.0 young per nest
hatched, and an average of 4.0 young per nest fledged. On Nantucket
maritime heath, Tate and others [45] found a mean clutch size of 5.7 in
1985. An average of 3.4 eggs hatched, and 2.0 young per nest fledged. In
1986, mean clutch size was 7.7, with an average of 7.0 eggs hatching and
3.4 young per nest fledging.

Migration - Much remains to be discovered about short-eared owl
migration dates and routes. The short-eared owl is well adapted to heat
and cold. As a result, it is apparently only weakly migratory [28].
Short-eared owl populations at the edge of the species' northern
distribution move south in late summer or early fall, but it is unclear
whether more southerly populations migrate or remain in an area as
permanent residents. Banding records are few, but limited studies show
that some individuals in populations south of taiga are regular
migrants. Others are irregular migrants, leaving in some years but not
others. Some owls probably migrate to new areas as young adults, then
become permanent residents. Migration routes are generally north-south,
but not always. Some migrants, for example, move back and forth from
North Dakota and eastern Oregon [12].

Except for populations at climatic extremes, when entire populations
migrate it is usually in response to depletion of the prey base rather
than seasonal climate changes. Short-eared owl rapidly move out of an
area bereft of prey, and rapidly move into areas where rodent
populations are rising [12,29,34].

Longevity - Captive birds have lived to age 15. It is unknown how long
short-eared owl usually survive in the wild [28].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Short-eared owl nestlings give high pitched calls from within the egg, and from hatching until they are about 7 days old. These are probably begging calls or perhaps expressing discomfort. The vocal pitch changes at about 7 days and becomes lower. Adults sometimes direct calls at human territorial intruders. Both males and females bark, scream, whine, and give broken wing distraction displays to defend the nest and young from potential threats. In late February and March, territorial songs are sung. (Holt and Leasure, 1993)

Short-eared owls have keen vision, especially in low light. They also use their excellent sense of hearing to help locate and capture prey.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Short-eared owl nestlings give high pitched calls from within the egg, and from hatching until they are about 7 days old. These are probably begging calls or perhaps expressing discomfort. The vocal pitch changes at about 7 days and becomes lower. Adults sometimes direct calls at human territorial intruders. Both males and females bark, scream, whine, and give broken wing distraction displays to defend the nest and young from potential threats. In late February and March, territorial songs are sung. (Holt and Leasure, 1993)

Short-eared owls have keen vision, especially in low light. They also use their excellent sense of hearing to help locate and capture prey.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: May forage day or night; may favor late afternoon and early evening (Johnsgard 1988). Hunts chiefly at dawn and dusk (National Geographic Society 1983). Active day or night in Hawaii (Pratt et al. 1987, Berger 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Records are limited, but the longevity record for a wild short-eared owl is 4 yrs, 2 months. Causes of mortality include occasionally being hit by cars and airplanes, or being shot or trapped.

Range lifespan

Status: wild:
21.8 (high) years.

Average lifespan

Status: wild:
53 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Records are limited, but the longevity record for a wild short-eared owl is 4 yrs, 2 months. Causes of mortality include occasionally being hit by cars and airplanes, or being shot or trapped.

Range lifespan

Status: wild:
21.8 (high) years.

Average lifespan

Status: wild:
53 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.8 years Observations: There are anecdotal reports of animals living up to 28 years but these have not been confirmed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The difficulty of owl reproduction lies in their usually individualistic habits; a great amount of the effort goes into learning mutual recognition as mating partners rather than prey or predator. They even have some difficulty identifying the gender of prospective mates from a distance. Male short-eared owls use an aerial display that includes wing clapping to alert the female of his presence and sex. Males also may offer food to females; this prevents females from considering the male as food.

Pair formation begins in mid-February and continues through June. Breeding usually begins in April. Short-eared owls are reported to also raise a second brood although this is not confirmed.  To attract females, males perform sky dancing displays, day or night. The sky dance consists of song accompanied by aerial acrobatics. Short-eared owls are generally thought to be monogamous; however, the pair bond probably does not last beyond the breeding season. (Holt and Leasure, 1993)

Mating System: monogamous

After sufficient time and caution has been taken, the male mounts the female. One observer reported that copulation took 4 seconds, after which the male and female flew in different directions. Breeding usually takes place while in their summer habitat, but they may breed in their wintering area if food is plentiful. Short-eared owls nest on the ground in protection provided by tall grasses; they often return to the same nests. Each nest contains 4 to 7 white, unspotted eggs. The eggs have an average incubation of 21 days. Nestlings have been known to prey on their smaller nest mates. The young usually disperse from the nest when they are about 14 to 17 days old. They are independent 1 to 2 weeks after fledging. (Holt and Leasure, 1993; Sparks and Soper, 1989; Pearson, 1936; Welty, 1975)

Breeding interval: Short-eared owls typically breed once yearly in the spring. Second broods have been reported but data is still needed to confirm this.

Breeding season: Short-eared owls typically breed late March to June, but mostly in April. In the southern hemisphere, breeding begins in September.

Range eggs per season: 1 to 11.

Average eggs per season: 5.6.

Range time to hatching: 21 to 37 days.

Range fledging age: 24 to 36 days.

Range time to independence: 31 to 43 minutes.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 6.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Only females brood and feed nestlings, while male provide food and defend the nest with distraction displays and vocalizations. Females protect nestlings from some weather conditions by brooding when young, and mantling when larger. When they are born young are semi-altricial, which means that they are relatively immobile and helpless when they hatch, but are down-covered rather than naked.  (Holt and Leasure, 1993)

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

See Johnsgard (1988) for egg dates (timing of nesting varies with latitude and prey abundance). Often only the oldest chicks survive.

COURTSHIP AND TERRITORIAL DEFENSE: Wing-clapping, exaggerated or deep wing-beats, and skirmishing are three displays seen predominantly during the breeding season (Lockie 1955, Clark 1975). Short-eared owls wing-clap along territorial boundaries or during flights within a territory, in aggressive displays to other birds or to human observers, and in courtship flight. When wing-clapping, the owl's wings are brought below the body and clapped together in short, rapid bursts. Both males and females may wing-clap. The courtship flight is unique and involves song, a spiraling flight, and wing-clapping by the male (DuBois 1924, Mikkola 1983, Holt 1985). Exaggerated wing-beats also occur in the same contexts as wing-claps. In this behavior the owl brings its wings high over its body, prominently displaying the underwing. Owls often patrol territorial boundaries using exaggerated wing-beats. Skirmishing involves other neighboring owls, usually along territorial boundaries, and is aggressive and territorial in nature. Exposure of talons, hovering, and sometimes actual striking of the other bird is involved. Any of these displays observed during the breeding season may signify a territorial bird. Observation and mapping of these behaviors over a nesting season is the best way to delineate an owl's breeding territory (Lockie 1955, Village 1987, Tate 1991).

Generally begin courtship in mid- to late March on Nantucket Island along the coast of Massachusetts (Holt and Melvin 1986; Tate and Melvin 1987, 1988). Courtship has been reported as occurring in mid-March in Montana (Dubois 1924) and as early as late February in Jefferson County, New York (G. Smith, pers. comm.). Pitelka et al. (1955) reported initial courtship activity in the first week of June at Barrow, Alaska. Unpaired males may engage in courtship flights well into the breeding season (Clark 1975; G. Tate, pers. obs.). The breeding season is often reported to commence in direct relation to vole abundance with a larger prey population yielding an earlier start to breeding activities (Randall 1925, Snyder and Hope 1938, Lockie 1955, Mikkola 1983).

NESTING: Depending on latitude, nesting activities generally begin in late winter to early spring across the owl's distribution. Timing of nesting may be correlated with latitude and prey abundance (Mikkola 1983, Cramp 1985). The nesting cycle from nest initiation to fledging of young takes approximately seven to nine weeks in temperate zones lasting from mid-March to mid-September in the Northeast Region. During a four-year study of breeding ecology on Nantucket Island, egg-laying began in April each year (as early as the first week) and all young were fledged by the first week of September (Holt and Melvin 1986; Tate and Melvin 1987, 1988; Combs and Melvin 1989). Late nests or renests accounted for young fledging in late August and September (Tate and Melvin 1987, 1988). Polygyny may result in two nests within one short-eared owl territory. On Nantucket, two broods from different females that overlapped temporally were raised within a territory defended by a single male (Tate 1991).

Unlike most owls that nest in holes or take over the abandoned nests of crows or other birds, the short-eared owl is unique within its family (Strigidae) in building a nest, albeit a crude one, on the ground. The female makes a small scrape in the ground with her body and lines it with nearby material. Nests may be lined with grass, leaves, twigs or feathers (Bent 1938, Clark 1975). These small nest depressions do not last long after the young have dispersed from the site (G. Tate, pers. obs.).

Generally between four and nine eggs are laid, and sometimes more (Bent 1938), although Mikkola (1983) reported a range of two to 13 from 121 European records. Murray (1976) reported a mean clutch size of 5.61 from 186 nests in North America. A trend for mean clutch size to increase from south to north was also noted in this sample. The largest clutch ever reported in the literature is 16 from Finland (Mikkola 1983). Large clutches of 14 in Scotland (Adair 1982) and 13 from Finland (Mikkola and Sulkara 1969) have also been reported. All exceptionally large clutches were laid in years of peak vole abundance in these areas.

Clark (1975) reported a mean clutch of 8.6 from five clutches in 1969 in Manitoba, Canada. Pitelka et al. (1955) reported a range in clutch size of four to eight with a mean of 6.3 from 22 nests in Alaska. A four-year study of nesting owls on Nantucket reported clutch sizes of 5.8 (n = 6), 7.7 (n = 9), 6.8 (n = 8), and 5.2 (n = 8) in 1985-88 respectively, with an inclusive range of four to nine (Holt and Melvin 1986; Tate and Melvin 1987, 1988; Combs and Melvin 1989).

Two broods are sometimes raised and, if the nest is destroyed or depredated, the female may renest (Lockie 1955, Mikkola 1983). Pitelka et al. (1955) saw no evidence of renesting by short-eared owls in Alaska; this was apparently tied to the shorter season. In 1986 and 1987, single late nests with eggs were found on Nantucket in mid-July (G. Tate, unpubl. data). These were suspected to be either second broods or renests.

Witherby et al. (1938) reported an incubation period of 24-28 days in temperate zones. With data from six eggs in four nests, Pitelka et al. (1955) reported an incubation period for Barrow, Alaska, that ranges from 26-37 days (mean = 30). He saw no evidence that incubation takes longer there than at lower latitudes. From a Finnish study of four nests, Gronlund and Mikkola (1969) reported an incubation period of 24-29 days (mean = 25.7). In 1986, three eggs, each from separate nests on Nantucket, were documented as having 29-, 30-, and 31-day incubation periods (mean = 30) (Tate 1991).

Normally the female does all of the incubation (Witherby et al. 1938, Dement'ev et al. 1951, Pitelka et al. 1955, Clark 1975) and lays at approximately 24-hour intervals (Mikkola 1983). She begins incubation with the first egg laid and hatching is therefore asynchronous. According to Mikkola (1983), the first and last eggs laid take the same length of time to incubate. Young owls leave the nest before fledging and wander into the surrounding area at about two weeks of age (Lockie 1955, Clark 1975). The young owlets stay concealed but continue to wander and are found and fed by both parents by means of the food-begging call given by the young. Fledging has been reported variously at 24-27 days (Witherby et al. 1938) and 31-36 days (Urner 1923). On Nantucket, young owls dispersed from the nest at 14-17 days and fledged when about 30 days old (Holt and Melvin 1986).

Age of first breeding is reported as one year or less (Mebs 1966, cited by Mikkola 1983; Glutz von Blotzheim and Bauer 1980). Field evidence of breeding at one year has been obtained on Nantucket in 1990, when a sitting female that had been banded as a nestling in 1989 was trapped. This female was brooding on a nest only 98 m from her natal nest site (K.P. Combs unpubl. data). These owls have been known to live as long as 12.5 years (Mebs 1966, cited by Mikkola 1983).

Short-eared owls usually offer little defense of the nest from human intruders. Wing-clapping, circling overhead with deep wing beats, "barks" or "yaps," and broken-wing acts are employed when any defense is attempted. Adults perform a distraction display that is a dramatic broken-wing act accompanied by vocalization. It is most often used by the male when an observer is at, or near, a nest or dispersed young (Clark 1975; G. Tate, pers. obs.). However, often both owls vacate the vicinity of the nest site while an intruder is present. At times the female may desert the area, retreating to another part of the breeding territory, while the male remains nearby. Females may return to the nest by flying low and remaining inconspicuous (G. Tate, pers. obs.).

While short-eared owls have been observed diving at house cats (G. Tate, pers. obs.), the best defense is their cryptic coloration and the fact that the female sits tightly on the nest. On Nantucket, some females remained on the nest while observers passed within two meters, and on Tuckernuck Island, a female on a nest would not budge in spite of repeated attempts from as close as one meter to flush her (G. Tate, pers. obs.). These behaviors make it extremely difficult to find nests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Owls usually live on their own so they have to learn to recognize each other as mating partners rather than prey or predator. They have some difficulty identifying the gender of prospective mates from a distance. Male short-eared owls use an aerial display that includes wing clapping to alert the female of his presence and sex. Males also may offer food to females; this prevents females from considering the male as food.

Males and females begin to form pairs in mid-February, continuing through June. Breeding usually begins in April. Short-eared owls are reported to also raise a second brood during the warm season, although this is not confirmed.  To attract females, males perform sky dancing displays, day or night. The sky dance consists of a song accompanied by aerial acrobatics. Short-eared owls are generally thought to be monogamous; however, the pair bond probably does not last beyond the breeding season. (Holt and Leasure, 1993)

Mating System: monogamous

Breeding usually takes place in the summer habitat of short-eared owls, but they may breed in their wintering area if food is plentiful. They nest on the ground in protection provided by tall grasses, often returning to the same nests. Each nest contains 4 to 7 white, unspotted eggs. The eggs have an average incubation of 21 days. Nestlings have been known to prey on their smaller nest mates. The young usually disperse from the nest when they are about 14 to 17 days old. They are independent 1 to 2 weeks after fledging. (Holt and Leasure, 1993; Sparks and Soper, 1989; Pearson, 1936; Welty, 1975)

Breeding interval: Short-eared owls typically breed once yearly in the spring. Second broods have been reported but data is still needed to confirm this.

Breeding season: Short-eared owls typically breed late March to June, but mostly in April. In the southern hemisphere, breeding begins in September.

Range eggs per season: 1 to 11.

Average eggs per season: 5.6.

Range time to hatching: 21 to 37 days.

Range fledging age: 24 to 36 days.

Range time to independence: 31 to 43 minutes.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average eggs per season: 6.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Only females brood and feed nestlings, while male provide food and defend the nest with distraction displays and vocalizations. Females protect nestlings from some weather conditions by brooding when young, and mantling when larger. When they are born young are semi-altricial, which means that they are relatively immobile and helpless when they hatch, but are down-covered rather than naked.  (Holt and Leasure, 1993)

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Asio flammeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTGGCACCTTATACCTAATCTTCGGTGCATGAGCCGGCATGGTTGGTACCGCCCTCAGCCTACTCATCCGGGCTGAACTAGGTCAACCCGGAACACTTCTAGGGGAT---GACCAGATCTATAATGTAGTAGTTACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTCATACCTATCATGATTGGTGGGTTCGGAAATTGATTAGTCCCATTAATAATTGGAGCCCCAGACATAGCCTTCCCGCGTATAAACAACATAAGCTTCTGACTTCTTCCCCCCTCATTCCTACTTCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACAGTCTACCCCCCATTAGCCAGCAACCTAGCCCACGCTGGAGCCTCAGTAGACCTGGCTATTTTCTCCTTACACCTAGCCGGAGTCTCCTCTATCCTAGAAGCAATTAACTTTATCACAACCGCCATCAACATAAAACCTCCATCCCTNTCACAATATCAAACCCCACTATTCGTATGATCTGTACTCATTACTGCCATCCTCCTACTGCTATCTCTTCCAGTACTAGCTGCAGGAATCACCATACTCCTCACAGATCGCAACCTAAACACCACATTCTTTGACCCCGCTGGCGGCGGTGACCCAATCCTCTACCAACACCTTTTCTGATTCTTTGGACACCCCGAAGTATACATCCTTATTTTACCAGGTTTTGGAATTATCTCGCACGTAGTACGGTACTATGCGGGCAAAAAAGGGCCATTNGGCTACATAGGCATAGTGTGAGCCATACTATCAATTGGATTCCTAGGTTTCATCGTTTGAGCCCATCACATATTCACAGTAGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Asio flammeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5