Overview

Brief Summary

The Pileated Woodpecker (Dryocopus pileatus) is the largest woodpecker in North America (excluding the, sadly, almost surely extinct Ivory-billed Woodpecker). Pileated Woodpeckers feed mainly on ants and other insects, excavating deep into rotten wood with their powerful bills, but also eat a significant amount of fruit and nuts. Carpenter ants may account for up to 60% of the diet and wild fruits, berries, and nuts may account for a quarter of the diet. Pileated Woodpeckers leave characteristic rectangular or oval holes in dead trees.

Pileated Woodpeckers are resident from much of Canada south along the western coast of North America to central California (and in Idaho, Montana, and Wyoming) and across most of the eastern United States, especially in the Southeast. They are found mainly in mature deciduous and mixed deciduous-coniferous forests, woodlots, and swamps, but also in coniferous forest. Pileated Woodpeckers became rare in eastern North America with the clearing of forests after European colonization of the continent. However, populations increased during much of the 20th century and these woodpeckers can even be seen around the edges of cities in parks and suburbs.

Pileated Woodpeckers defend their territories with loud drumming and calling. Courtship displays include spreading the wings (displaying white wing patches), erecting the crest, swinging the head back and forth, and performing a gliding display flight. At a prospective nest site, both sexes may tap or drum on wood. The nest site is a cavity in a dead tree (or dead branch of a live tree), sometimes in a utility pole, usually 15 to 80 feet above the ground. A new cavity is generally excavated each year, with both sexes excavating. The 3 to 5 white eggs are incubated by both sexes for around 18 days (with the male incubating at night and during part of the day). The young are fed (by regurgitation) by both parents. They leave the nest after 26 to 28 days, but may remain with the parents for 2 to 3 months.

Although Pileated Woodpeckers are generally permanent year-round residents, some individuals may wander far from breeding areas.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Resident through forested North America from Nova Scotia, New Brunswick, s. Quebec, and central Ontario south to s. Florida, and west to forested river bottoms extending into the Great Plains in e. Texas and se. Oklahoma. The winter range is also the same. A permanent resident of deciduous or coniferous forests in southern Canada and in the western, midwestern, and eastern United States.

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: from southern and eastern British Columbia and southwestern Mackenzie across southern Canada to Quebec and Nova Scotia, south in Pacific states to central California, in the Rocky Mountains to Idaho and western Montana, in the central and eastern U.S. to the eastern Dakotas, Gulf Coast, and southern Florida, and west in the eastern U.S. to Iowa, Kansas, Oklahoma, and Texas (AOU 1983). Absent from or very limited in much of northern Illinois, Indiana, and Ohio. In the Great Plains, found primarily along the eastern edge in bottomland forests along major streams. In recent years, however, there have been increasing numbers of records farther west than illustrated in Bull and Jackson (1995). In Oklahoma these include records west to Major, Caddo, Woodward, and Comanche counties, Oklahoma (Ely 1990, Baumgartner and Baumgartner 1992, McGee and Neeld 1972, Powders 1986). Also reported from Nebraska (Rapp 1953), a return after disappearance at the end of the last century. Maps in Winkler et al. (1995) show the species much farther north in western Canada than known. See also range map for Canada in Godfrey (1986). There are many extralimital records. In the east, occurs from sea level to 1500+ m in the Appalachians; in California to about 2300 m (Short 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Pileated Woodpecker is the largest woodpecker found in most of North America. Only the possibly extirpated Ivory-billed Woodpecker (Campephilus principalis) in the southeastern United States and Cuba and the Imperial Woodpecker (Campephilus imperialis) of western Mexico are larger. Dryocopus pileatus is best recognized by its large, dull black body and red crest. Because of its size and chisel-shaped bill, this woodpecker is particularly adept at excavating, and it uses this ability to construct nests and roost cavities and to find food.

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 364 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 42 cm

Weight: 308 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Except for the probably extinct ivory-billed woodpecker (CAMPEPHILUS PRINCIPALIS) of the southeastern United States and imperial woodpecker (C. IMPERIALIS) of montane western Mexico, the pileated is the largest woodpecker in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coniferous or deciduous forest. Prefers to nest in mesic areas, close to streams; selects stands with greatest basal area, greatest density of stems, and highest crown canopy. Typically roost in hollow trees with multiple entrances.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Dense deciduous (favored in southeast), coniferous (favored in north, northwest and west), or mixed forest, open woodland, second growth, and (locally) parks and wooded residential areas of towns. Prefers woods with a tall closed canopy and a high basal area. Most often in areas of extensive forest or minimal isolation from extensive forest. Uses a minimum of 4 cavities per year (only one for raising brood).

In Missouri, abundance increased with area covered with bottomland forest, density of trees at least 30 cm dbh, and density of snags at least 54 cm dbh (Renken and Wiggers 1993). In West Virginia found in all forest types, at all elevations, but less common in spruce-northern hardwoods forest and most common in mixed hardwood forest (Hall 1983).

Nests are in cavities excavated by both sexes usually in dead stubs in shaded places; cavity entrance averages about 14 m above ground (see photos and descriptions in Harrison 1975, 1979). Usually digs a new hole for each year's brood, but the same cavity may be used for several years. Nest tree species and size varies among regions and even within regions depending on site and availability. In southern British Columbia, preferred nest sites were in live aspen with heartwood decay, in trees larger than 40 cm dbh (Harestad and Keisker 1989). In northwest Montana, most of 54 nest trees were large western larch (LARIX OCCIDENTALIS) and nest trees averaged 74.9 cm dbh (McClelland 1979). In northeast Oregon, 75% of nest trees were ponderosa pine (PINUS PONDEROSA) and mean dbh of nest trees was 84 cm (Bull 1987). In western Oregon, 73% of nest trees were Douglas-fir (PSEUDOTSUGA MENZIESII) and nest trees averaged 69 cm dbh (Mellen 1987). In Virginia, 28% of nest trees were hickory (CARYA spp.), 22% red oak (QUERCUS RUBRA), 17% chestnut oak (Q. PRINUS) and nest trees averaged 54.6 cm dbh (Conner et al. 1975). Most studies report nests 5-17 m above ground in wood softened by fungal rot, in trees usually 100-180 years old, over 51 cm DBH, 12-21 m tall, and often near permanent water (Bushman and Therres 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Although generally considered to be a resident species, there is evidence of some migratory movement in the northern part of its range. Hall (1983) reported a small southward movement of pileated woodpeckers in fall along the Allegheny Front of West Virginia. Sutton (1930) also noted gradual southward movement in fall through New York state. In British Columbia, the paucity of winter records in the northern half of the province indicates that many breeding individuals there move considerable distances to the south (Campbell et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

This woodpecker feeds on insects, primarily carpenter ants and woodboring beetle larvae; also wild fruits and nuts. It pries off long slivers of wood to expose ant galleries. The Pileated Woodpecker uses its long, extensible, pointed tongue with barbs and sticky saliva to catch and extract ants from tunnels.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds extensively on carpenter ants (CAMPONOTUS spp.) and beetle larvae obtained by chiseling into standing trees, stumps, and logs; also digs into anthills on ground and eats other insects, fruits, and seeds (Hoyt 1957). In Wisconsin, Nicholls (1994) found the cerambycid wood borer, TRIGONARTHRIS, to be the major prey of pileated woodpeckers feeding at dead American elms (ULMUS AMERICANA). The preference of the birds for feeding at larger trees seemed related to the requirement of the beetles for larger trees as their habitat. There tends to be seasonal variation in the diet and foraging strategy to take advantage of available foods. More fruit and seeds are taken in late summer and fall (Conner 1979, Hoyt 1948, Sprunt and Chamberlain 1970); more excavation for arthropods is done in winter (Conner 1979, Hoyt 1948, Pfitzenmeyer 1956, Tanner 1942). Quantitative studies of diet include stomach content and scat analysis. In a range-wide, year-round study, Beal (1911) found 80 stomachs to include 22% beetles (Cerambycidae, Buprestidae, Elateridae, Lucanidae, Scarabaeidae, Carabidae), 40% ants (CAMPONOTUS sp., CREMATOGASTER sp.), 11% other insects, and 27% vegetable (numerous fruits, see Bull and Jackson 1995). Analyses of 330 scats in Oregon revealed 68% carpenter ants, 29% thatching ants (FORMICA), 0.4% beetles, and 2% other. The species is opportunistic, known to take advantage of insect outbreaks (e.g., western spruce budworm (CHORISTONEURA OCCIDENTALIS) Bull and Jackson 1995), the progression of fruiting trees in an area (Stoddard 1978), and to visit suet feeders in many areas of eastern North America (Connecticut, Hardy 1958; Mississippi, Jackson, pers. obs.; Tennessee, Spofford 1947; Georgia, Stoddard 1978; Minnesota, Tusler 1958 ).

Logs and stumps are important foraging substrates in many areas (e.g., Mannan 1984, Renken and Wiggers 1989, Schardien and Jackson 1978), but Aubry and Raley (1992) rarely observed foraging on logs in closed canopy forests of western Washington. Mannan (1984) found the pileated to forage on dead wood substrates 96% of the time.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Many occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Geographic variation in abundance is linked to availability and quality of habitat. Comparative data are few, but Price et al. (in press, and in Bull and Jackson 1995) show areas of greatest numbers on U.S. Fish and Wildlife Service Breeding Bird Surveys to be in the southeastern United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In Missouri, population density varied from 0.5 to 4.1 territories per 100 ha, with the highest densities of birds positively correlated with increasing area of old growth bottom land forest, increasing canopy closure, and increasing density of snags greater than 0.54 cm dbh (Renken and Wiggers 1993). In western Oregon, mature forests support higher populations than do younger forests (Mannan et al. 1980).

In Missouri, territory sizes ranged from 53-160 ha, and territory size decreased with increasing percent forest overstory canopy cover, increasing saw timber cover, and log and stump volume (Renken and Wiggers 1989). In conifer forests of northeastern Oregon, home range was 128-240 ha (Bull and Meslow 1977). Home range in New York varied in radius from 4.8 to 6.4 km in a mixed conifer-hardwood forest (Hoyt 1957) [Note: these data do not appear in the cited Hoyt 1957].

Parasites have rarely been reported, but include the following. Humpbacked flies (Phoridae), were found on nestlings in New York (Hoyt 1957). TOUCANECTES DRYOCOPI, a subcutaneous mite, was found in the head and neck region of Louisiana birds (Pence 1971). In Oregon nests, Wilson and Bull (1977) found DERMANYSSUS GALLINOIDES, a mite (Mesostigmata: Laelaptoidea) and CARNUS HEMAPTERUS, and a fly (Diptera: Milichiidae). Collins et al. (1966) identified two blood parasites, PLASMODIUM sp. and HAEMOPROTEUS sp. from a South Carolina bird. Nickol (1969) examined three Louisiana pileateds for Acanthocephala, but found none.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
155 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Dryocopus pileatus is oviparous, its incubation period is approximately 12-14 days. Both parents incubate eggs alternately during the day; the male incubates at night. The eggs are attended 99% of the time. Kilham (1979) reported that eggs were unattended for up to 20 minutes in the first few days; attended nearly 100% of the time after that. A clutch size of 4 is most common in this woodpecker.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 18 days.

Average eggs per season: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pairs share a territory year round (Bull and Jackson 1995). On warm days of February and early March in the southeastern U.S. and March through early April in northern areas there is an increase in vocalizations and drumming associated with pair formation and increased territoriality. Vocalizations and drumming take place with greatest frequency in early morning and late afternoon (Hoyt 1941). Courtship behavior is described in detail by Kilham (1979, 1983), with additional details and circumstances by Arthur (1934), Hoyt (1944), and Oberman (1989). Nest construction, egg-laying, hatching, and fledging are also progressively later from south to north (Bull and Jackson 1995) and likely from lower to higher altitudes (at least in California, Harris 1982).

Early egg dates in the southern U.S. are in early March; late egg dates, from northern areas, are in mid-June. Similarly, nestlings have been found from mid-May in the southeast to mid-July in the north (Bull and Jackson 1995, Peterjohn 1989). Young remain with adults at least through late summer or early fall. Clutch size is usually 3-4 throughout the range (Bent 1939, Christy 1939); a clutch of 6 was reported by Audubon and Chevalier (1842). Incubation takes 15-19 days (Bendire 1895, Hoyt 1944, Kilham 1979), by both sexes. Young are tended by both parents, leave nest at 22-26 days (Hoyt 1944, Bull and Jackson 1995).

Longevity records thus far include several birds surviving for 9 years (Bull and Jackson 1995, Bull and Meslow 1988, Hoyt and Hoyt 1951, Hoyt 1952). However, through 1981, there had only been 15 recoveries from a total of 670 banded (Clapp et al. 1983), thus it is quite possible that this species could live much longer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dryocopus pileatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCCACCAACCACAAGGACATTGGCACTCTGTATCTTATCTTCGGCGCATGAGCCGGCATAATCGGCACAGCCCTCAGCCTCCTTATNCGCGCTGAACTAGGCCAACCTGGCACCCTCCTCGGCGAC---GATCAAATCTACAACGTCATCGTTACCGCCCATGCATTCGTAATAATCTTCTTCATAGTCATACCCATCATGATTGGCGGGTTTGGAAACTNACTCGTCCCACTCATAATCGGAGCTCCCNACATAGCATTCCCACGAATGAACAACATAAGCTTNTGACTCCTCCCACCATNATTCCTGCTCCTTNTAGCNTCCTCCACAGTAGAGGCAGGGGCAGGAACAGGCTGAACTGTCTACCCGCCCCTCGCTGGCAACTTAGCCCATGCAGGAGCCTCAGTAGACCTGGCCATCTTCTCACTCCACCTAGCGGGTATCTCATCCATCCACGGGGCAATCAACTTTATTACCACGGCCATTAACATAAAACCCCCAGCCATCTCACAATACCAAACCCCTCTATTTGTCTGATCCGTCCTCATCACCGCTGTTCTCCTCCTCCTATCCCTCCCAGTCCTCGCCGCTGGCATCACGATACTCCTCACAGACCGCAATCTAAACACCACATTCTTTGACCCTGCCGGAGGGGGCGACCCAATCCTCTACCAACATCTCTTCTGATTTTTTGGCCACCCCGAAGTTTACATCCTCATCCTTCCAGGATTTGGCATGATCTCCCACGTAGTAGCCTACTACGCTGGCAAAAAAGNNNNTTTCGGCTACATGGGAATAGTATGAGCCATACTATCTATTGGATTCCTCGGCTTTATCGTATGAGCTCACCACATGTTCACCGTAGGGATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dryocopus pileatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5