Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Hairy Woodpeckers (Picoides villosus) occur from Alaska and most of Canada south to the Gulf Coast. In the southwestern United States and from Mexico to Panama they are found in mountain forests (mainly pines, but also in cloud forest in Middle America). They are found in a range of habitats that include large trees, including both open and dense forests.

In its range, the Hairy Woodpecker closely resembles the Downy Woodpecker (Picoides pubescens), but the Downy is much smaller, with a bill that is noticeably proportionately smaller relative to the head (i.e., the bill has a more "stubby" appearance), and the outer tail feathers have black barring that is lacking on the Hairy's tail (these outer feathers instead being entirely white on the Hairy Woodpecker). In both species, the male has a red hindcrown spot that is not present in the female. Hairy and Downy Woodpeckers are often found together, but the Hairy requires larger trees and is usually less common, especially in the eastern portion of its range, and less frequent in suburban settings and parks.

Hairy Woodpeckers eat mainly insects, especially larvae of wood-boring beetles, but also some berries, seeds, and nuts. They sometimes feed on sap at damaged trees (or where their woodpecker cousins the sapsuckers have been at work) and will come to bird feeders for suet. In the course of feeding, the Hairy Woodpecker does more pounding and excavating in trees than do most smaller woodpeckers, consuming large numbers of wood-boring insects.

The male and female maintain separate territories in early winter and pair up in mid-winter, often with their mate from the previous year. The female's winter territory becomes the focus of the nesting territory. Courtship includes the male and female drumming in a duet.. The nest site is a cavity excavated by both male and female, usually around 1 to 18 m above the ground. In the eastern part of the range, mainly deciduous trees are used while in the western part of the range nest cavities tend to be in aspens or dead conifers. The 4 white eggs (sometimes 3, 5, or 6) are incubated by both sexes for around 14 days (the male incubating at night and mainly the female during the day). The nestlings are fed by both parents. Males may forage farther from the nest, making fewer feeding trips with more food per trip. Young leave the nest 28 to 30 days after hatching, but the parents continue to feed them for some time. There is one brood per year.

Hairy Woodpeckers are generally year-round residents. At the northern end of the range, some birds may move south in the winter; in the western part of the range, some birds in the mountains may move to lower elevations in winter.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

This woodpecker ranges from Alaska to Newfoundland south from northern Mexico to Florida (Palmer and Fowler 1975). Some northern residents migrate south during the winter (Farrand, Jr. 1988), being found in Guatamala, Costa Rica, and Panama (Winkler et al. 1995).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western and central Alaska to northern Saskatchewan and Newfoundland, south to northern Baja California, highlands of Middle America, Gulf Coast, southern Florida, and Bahamas. WINTERS: generally throughout breeding range, with more northern populations partially migratory.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

This bird is approximately 16.5 to 26.7 cm. long. It has a wingspan of 44.5 cm., a tail length of 10.2 cm. and a bill length of 3.4 cm. Black and white streakings or checkerings are evident on the wings. Outer tail feathers are white and do not have black markings. On the male, there is a red patch on the back of the head, black crown, and black eye mask and nape of the neck. The female lacks the red patch. There is also white on the chest, abdomen, back, and rump. (Peterson 1967, Palmer and Fowler 1975, Winkler et al. 1995). Young birds may have red on their crown (Farrand, Jr. 1988).

Range mass: 84.5 to 85.5 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 24 cm

Weight: 70 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from the downy woodpecker in larger size (average length 24 cm vs. 17 cm), larger bill (about as long as head vs. obviously shorter than head), absence of black bars or spots on outer tail feathers (downy generally has spots), and sharper call note (peek! vs. pik). Differs from three-toed and black-backed woodpeckers in lacking dark barring on the sides (may be present on flanks of juveniles).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This woodpecker is found in forested areas, especially where dead trees are standing. Individual's range is a few acres (Palmer and Fowler 1975). In the northwestern to the western United States, Hairy Woodpeckers are found in douglas fir/western hemlock forests, open juniper woodland, and in riparian forests. In the eastern United States, the Hairy Woodpecker is found in all types of forests. In the tropics, this woodpecker is found in the mountains to a maximum of 3400 m in Panama (Winkler et al. 1995). This bird also frequents gardens and residential areas (Farrand, Jr. 1988)

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Forest, open woodland, swamps, well-wooded towns and parks, open situations with scattered trees. Most abundant in mature woods with large old trees suitable for cavity nesting; also common in medium-aged forests; prefers woods with a dense canopy (Bushman and Therres 1988). Uses tree cavities for roosting and winter cover; may excavate new cavities in fall to be used for roosting (Sousa 1987). Sleeps singly in holes usually carved by males (Stiles and Skutch 1989). In the eastern U.S., uses forest areas of 2-4 ha or larger, though a much larger area (maybe 12 ha) may be needed to support a viable breeding population; in Iowa the minimum width of riparian forest necessary to support a breeding population was 40 m (Sousa 1987). Overall, appears to be minimally impacted by forest fragmentation, though a few studies have reported a decline in numbers as forest patch size decreases; the presence of suitable cavity trees is a more important consideration (see Bushman and Therres 1988).

Nests in hole dug mostly by male in live or dead tree or stub, 1.5-18 m (average 9 m) above ground. In most areas, favors dead or dying parts of live trees, especially where fungal heart rot has softened the heartwood. Snag (25 cm or more in DBH) density of 5/ha assumed optimal for reproduction (but may not be adequate for foraging) (Sousa 1987). Nest tree DBH minimally 20 cm; averaged 27-28 cm in New England, 38 cm in Colorado, 41 cm in Virginia, 44 cm in California, and 92 cm in Oregon (Sousa 1987). See Sousa (1987) for fairly detailed summary of nesting habitat characteristics in different regions. Usually excavates new nest hole each year. May nest in utility pole or bird box.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Northernmost breeding populations partially migratory. May migrate between higher and lower elevations in mountainous regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The majority of their foodstuffs is insects, especially hairy caterpillars and their chrysalids, particularly the gypsy moth. Other insects include ants, grasshoppers and wood-boring beetles, other beetles and their grubs, crickets, and flies. They also eat spiders. They will eat a little vegetable matter including nuts, seeds, and some fruits (Palmer and Fowler 1975, Winkler et al. 1995). Hairy Woodpeckers will feed on suet in backyards (Winkler et al. 1995).

Foraging occurs on trees, bushes, stumps, vines, bamboo, reeds, sugar cane, and rotting branches and other debris on the ground. To obtain an insect, the Hairy Woodpecker will tap, probe, and pry at the bark of a tree, sometimes excavating deep into the bark. In the western United States, when leaves are budding, the Hairy Woodpecker will peck and tear at the buds to get at the hidden insects, in contrast to the Downy Woodpecker that uses probing and soft tapping (Short 1982).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly insects (beetles, ants, caterpillars), especially boring larvae, obtained from bark or wood of trunks and branches of trees or from soft shrubs or old giant thistle stalks; also eats other invertebrates and some fruits and nuts (Terres 1980). May concentrate feeding in areas of insect outbreaks. Sometimes feeds on sap from wells drilled in trees by sapsuckers. Seeds may be important food in winter. Uses various foraging substrates, ranging from dead and live trees to downed wood and ground; see Sousa (1987) for details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Picoides villosus (hairy and downy woodpeckers) preys on:
Saperda
Dicera

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Female spends entire year on breeding territory, joined in late winter by male (Harrison 1979). Reported territory size 0.6-15 hectares; varies with habitat quality. In central Ontario, breeding territories averaged 2.8 hectares, range 2.4 to 3.2 hectares (Lawrence 1967).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
191 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding occurs two to three months before nesting in February through June, depending on location within the Hairy Woodpecker's geographic range. In some locations, females maintain territories. They will advertise for a male by drumming. Once the pair-bond is formed, both male and female drum.

Excavation of the nest is accomplished for the most part by the male. Nest holes are made in dead branches or tree trunks, 4 to 60 m off the ground, in forests and orchards. Two to five white eggs are laid per clutch (Palmer and Fowler 1975, Short 1982, Winkler et al. 1995). The eggs average 23.8 by 18 mm in size (Bent 1992). Incubation is 14 days by both parents (Palmer and Fowler 1975, Short 1982, Winkler et al. 1995). The young leave the nest after 28 to 30 days (Winkler et al. 1995). Breeding occurs once annually (Palmer and Fowler 1975).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 14 days.

Average eggs per season: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nests early April to mid-June in Maryland (see Bushman and Therres 1988). Clutch size is 3-6 (usually 4). Incubation lasts 11-12 days, by both sexes. Young leave nest at 28-30 days, then rely on parents for about 2 more weeks, may return to nest to roost.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Picoides villosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCCACCAACCACAAAGACATTGGCACCCTATATCTCATCTTCGGCGCATGAGCCGGCATAATCGGCACCGCCCTTAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGCACCCTCCTTGGTGAC---GACCAAATCTACAACGTCATCGTCACCGCCCATGCATTCGTAATAATCTTCTTTATAGTTATACCCATCATAATTGGGGGATTTGGAAACTGACTCGTACCGCTCATAATTGGAGCCCCCGACATGGCATTCCCACGAATAAACAACATAANCTTCTGACTCCTTCCCCCATCATTCCTTCTCCTCCTAGCGTCCTCCACAGTAGAAGCGGGGGCTGGAACAGGATGAACTGTCTACCCACCCCTTGCTGGCAACCTAGCCCATGCAGGAGCCTCAGTAGACCTAGCCATCTTCTCACTCCACCTAGCAGGCATCTCATCAATCCTAGGGGCAATCAACTTCATCACAACAGCCATTAACATGAAACCCCCAGCCATCTCACAATATCAAACTCCCCTATTCGTCTGATCCGTCCTTATTACCGCCGTCCTCCTGCTCCTCTCACTCCCTGTACTTGCCGCTGGCATTACAATACTCCTCACAGACCGCAACCTAAACACTACATTCTTTGACCCCGCTGGAGGAGGGGACCCCATCCTCTACCAACATCTCTTCTGATTCTTTGGCCACCCCGAAGTCTACATTCTTATTCTTCCAGGATTTGGCATTATCTCCCACGTAGTAGCATACTACGCTGGCAAAAAAGAACCATTCGGCTACATGGGCATAGTATGAGCCATACTTTCCATTGGATTCCTCGGCTTCATCGTATGAGCCCATCACATGTTCACTGTAGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Picoides villosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5