Articles on this page are available in 2 other languages: Chinese (Simplified) (10), Spanish (15) (learn more)

Overview

Brief Summary

Biology

House sparrows feed mainly on seeds, but in the breeding season the adults will take some animal matter (mainly insects), and feed their young on insects for the first part of the nestling period (9). It is a regular visitor to garden bird tables and feeders (5). This sociable species nests in colonies, the untidy feather-lined nests are built in crevices and holes in buildings, tree holes and nest boxes (4). House sparrows are also known to occasionally evict other species of birds from their nests, subsequently occupying them (6). During the breeding season, house sparrows mate very frequently, so much so that their eggs were once highly prized as aphrodisiacs (6). After May, 3-5 whitish, blotched eggs are laid (4). The female incubates the eggs for up to 14 days, after which time both parents share the task of feeding the young for around 15 days (4). Three or more broods may be produced every breeding season (4). The gregarious nature of this sparrow is often most obvious during winter, when most activities including feeding, roosting and bathing, are carried out in groups or large flocks (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 3.75 of 5

The House Sparrow (Passer domesticus) is native to Eurasia and the northern edge of the African continent, but is now found in most regions of the world where humans live. This species is mainly associated with humans, living around buildings in settings ranging from isolated rural farms to major urban centers, although population density and breeding success are generally higher in suburban environments than in cities or rural areas.

House Sparrows have a mainly vegetarian diet, feeding especially on weed and grass seeds or waste grain, but also on buds, berries, and a range of scraps from humans. During the summer, animal material can account for as much as 10% of the diet and, as opportunists, House Sparrows may take small frogs. mollusks, and crustaceans where available. Nestlings are fed mainly insects for the first few days after hatching .

House Sparrows generally occur in flocks, often quite large ones outside the breeding season. Breeding is mainly in loose colonies of 10 to 20 pairs. Nest building is initiated by an unmated male, but assisted by his mate after pair formation. Nests are typically built in artificial or natural cavities or crevices. These birds are remarkably catholic in their choice of a nest site, with nests reported from moving machinery and even from 640 m below ground in a coal mine in England. Clutch size is typically 3 to 6 eggs. Incubation (for 10 to 14 days) is by both parents. Both parents also feed the nestlings, which leave the nest around two weeks after hatching. Two or three clutches are typically produced each year.



House Sparrows are non-migratory over most of their native and introduced range. This species is among the more abundant birds in the world: the total European population in the 1980s and 1990s probably exceeded 50,000,000 breeding pairs, with an estimated world total of around 500,000,000 pairs. However, significant population declines have been reported in recent years over parts of the native and introduced range (although range expansion elsewhere has continued).

(Kaufman 1996; Summers-Smith 2009 and references therein)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

The sparrow is one of Britain's most well-known and best-loved birds. Both sexes have a brown back streaked with black. Males and females are easily distinguished; males have a black bib, a grey crown with chestnut sides, and white cheeks. Females and juveniles have a duskier appearance, and lack the black bib seen in males (2). It is a very vocal species, producing a great range of familiar chattering and chirping, and a 'cher'r'r' when squabbling (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Passer domesticus

A medium-sized (6 inches) Old World sparrow, the male House Sparrow is most easily identified by its mottled brown back, gray belly and crown, black “bib,” white cheeks, and chestnut head patches. Females are mottled gray-brown overall with a faint pale eye stripe. This species may be confused with a several other brownish species of Old World sparrows, but is almost unmistakable in areas where it occurs alone. House Sparrows are unrelated to similarly-patterned New World “sparrows,” which are in the same family as the Old-World buntings. The House Sparrow is native to Europe, North Africa, and parts of West and South Asia. Today, this species inhabits almost every temperate and subtropical locality on earth as a result of introductions by humans. Notable releases include that of around one hundred birds in Brooklyn, NY in the early 1850s, after which began the House Sparrow’s colonization of the United States and southern Canada. Other non-native populations exist in southern South America, South Africa, Australasia, and on oceanic islands around the world. Some House Sparrows in Central Asia migrate short distances south during the winter, while native and non-native populations elsewhere are non-migratory. House Sparrows inhabit an extraordinary variety of habitats around the world, including subtropical forests, dry deserts, temperate forests, and grasslands. This species is particularly successful at utilizing human-altered environments, and is found in high concentrations in agricultural and urban areas where food and man-made nesting sites are plentiful. House Sparrows primarily eat seeds and grains, including important cereal crops, although this species will also eat insects during the summer. In temperate and subtropical parts of the world, the House Sparrow is often one of the most visible bird species, particularly in urban areas. House Sparrows may be observed foraging for food in fields, hedgerows, parks, and even on bare sidewalk. This species is a cavity nester, and, as its name suggests, is particularly attracted to nesting in the eaves of buildings. House Sparrows are primarily active during the day.

Threat Status: Least Concern

  • House Sparrow (Passer domesticus). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Lowther, Peter E. and Calvin L. Cink. 2006. House Sparrow (Passer domesticus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/012
  • Passer domesticus. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - House Sparrow. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Summary

"A small bird, generally associated with human habitation. Females and young birds are coloured pale brown and grey, and males have brighter black, white, and brown markings."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The House Sparrow is distributed worldwide (excluding the Poles). It is native to Eurasia and North Africa. It was introduced into S. Africa, South America, Australia, New Zealand, and America. Its introduction into North America occured in 1851, when a group of 100 birds from England was released in Brooklyn, New York.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Native to Old World (northern Scandinavia and northern Siberia south to northern Africa, Arabia, India, and southeast Asia). Introduced and established as a resident from the north coast of British Columbia and southern Yukon to Newfoundland, south to South America, West Indies (including Puerto Rico, where the species is uncommon and local on the south coast and a flock of 60 was found on Isla Mona in 1987), Hawaii (all main islands), south and east Africa, Australia, New Zealand, and many other areas of world (AOU 1998). Expansion continues in South America unaided by humans (Ridgely and Tudor 1989). Accidental (3 records) in Alaska; two vagrants in southeastern Alaska probably came from the North American exotic population, but one from St. Lawrence Island undoubtedly came from an introduced population on the Chukotsk Peninsula (Kessel and D. Gibson, University of Alaska Museum, unpublished records).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

House Sparrows are distributed almost worldwide, excluding the polar regions. They are native to the Palearctic and Ethiopian regions and have been introduced to the Nearctic, Neotropical, and Australian regions. Their introduction into North America occured in 1851, when a group of 100 birds from England was released in Brooklyn, New York.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread throughout Britain, but has undergone a drastic decline during the last 25 years. There are regional differences in the decline, but it has been most severe in the east of England, with a shocking reduction of 90% since 1970 (8). Elsewhere, this cosmopolitan species is found throughout Europe, North Africa, the Middle East, India and Burma, and across central Asia. It has been introduced to New Zealand, Australia, and North and South America (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The House Sparrow is a stout, stocky sparrow, with shorter legs and a thicker bill than indigenous American sparrows. Members of both sexes are brown backed with black streaks throughout this area. Its underside is pale buff. Males have white cheeks and a black bib, while females do not. The tail is usually three-quarters the length of the wing. Wing length is 76 mm and average mass is 28.5 grams.

Average mass: 28.5 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 25.3 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Female earthy-brown streaked with black and rufous above, whitish below."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

House Sparrows are a stout, stocky sparrow, with shorter legs and a thicker bill than native American sparrows. Members of both sexes are brown backed with black streaks throughout this area. Their undersides are pale buff. Males have white cheeks and a black bib, while females do not. The tail is usually three-quarters of the length of the wing. Males are slightly larger than females. Wing length is 76 mm and average mass is 28.5 grams.

Average mass: 28.5 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 25.3 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 16 cm

Weight: 28 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Well known. Smaller than the Bulbul. (6"""")."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

House Sparrows like areas that have been modified by humans, including farms, residential, and urban areas. They are absent from uninhabited woodlands, deserts, forests, and grasslands.

Habitat Regions: temperate ; terrestrial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: North America: cities, villages, farms, parks. Nests in cavities and in crevices of structures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

An unfailing commensal of Man
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In North America House Sparrows prefer areas that have been modified by humans, including farms, residential areas, and urban areas. They are absent from uninhabited woodlands, deserts, forests, and grasslands.

Habitat Regions: temperate ; terrestrial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Closely associated with permanent human habitations, including farmyards, villages, parks, suburban areas and city centres (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

House Sparrows eat various kinds of seed supplemented by some insects. Rural birds tend to eat more waste seed from animal dung and seed from fields, while urban birds tend to eat more commercial birdseed and weed seed. Studies of the contents of House Sparrow stomachs in Alabama, Conn., Illinois, Iowa, Mass., Michigan, Miss., Penn., and Vermont have shown approximate amounts of seed to be 60% livestock feed (corn, wheat, oats, etc.), 18% cereals (grains from storage or from fields), 17 % weed seed, and 4% insects.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats seeds, grain, and (in summer) insects and other invertebrates and small fruits (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

House sparrows eat various kinds of seeds supplemented by some insects. Rural birds tend to eat more waste seed from animal dung and seed from fields, while urban birds tend to eat more commercial birdseed, weed seed, and human trash. Studies of the contents of house sparrows' stomachs in Alabama, Connecticut, Illinois, Iowa, Massachusetts, Michigan, Missouri, Pennsylvania, and Vermont have shown approximate amounts of seed to be 60% livestock feed (corn, wheat, oats, etc.), 18% cereals (grains from storage or from fields), 17 % weed seed, and 4% Insecta.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

House sparrows are abundant near human habitations. In these areas they serve as an important prey base for birds of prey and they may have an impact on plant communities because they consume large quantities of seeds. House sparrows seriously impact populations of native birds, such as bluebirds, chickadees, cliff swallows, and some woodpeckers. House sparrows take over the nesting cavities of native birds, including expelling adults and nestlings by force.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Many hawks and owls hunt and feed on house sparrows. These include Cooper's hawks, merlins, snowy owls, eastern screech owls, and many others. Known predators of nesting young or eggs include cats, domestic dogs, raccoons, and many snakes. House sparrows avoid predation by foraging in small flocks so that there are many eyes watching out for potential predators.

Known Predators:

  • hawks (Accipitridae)
  • falcons (Falconidae)
  • owls (Strigiformes)
  • northern shrikes (Lanius excubitor)
  • domestic cats (Felis silvestris)
  • domestic dogs (Canis lupus familiaris)
  • raccoons (Procyon lotor)
  • black rat snakes (Pantherophis obsoletus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

House sparrows are abundant near human habitations. In these areas they serve as an important prey base for birds of prey and they may have an impact on plant communities because they consume large quantities of seeds. House sparrows seriously impact populations of native birds, such as Sialia, Parus, Petrochelidon pyrrhonota, and some Picoides. House sparrows take over the nesting cavities of native birds, including expelling adults and nestlings by force.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Many Accipitridae and Strigiformes hunt and feed on house sparrows. These include Accipitridae, Falco columbarius, Nyctea scandiaca, Otus asio, and many others. Known predators of nesting young or eggs include Felis silvestris, Canis lupus familiaris, Procyon lotor, and many Squamata. House sparrows avoid predation by foraging in small flocks so that there are many eyes watching out for potential predators.

Known Predators:

  • hawks (Accipitridae)
  • falcons (Falconidae)
  • owls (Strigiformes)
  • northern shrikes (Lanius_excubitor)
  • domestic cats (Felis_silvestris)
  • domestic dogs (Canis_lupus_familiaris)
  • raccoons (Procyon_lotor)
  • black rat snakes (Elaphe_obsoleta)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite / blood sucker
adult of Oeciacus hirundinis sucks the blood of nestling of Passer domesticus
Other: minor host/prey

Animal / predator
Passer domesticus is predator of adult of Bruchus pisorum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Passer domesticus is prey of:
Strigiformes
Accipitridae
Falconidae
Elaphe obsoleta
Lanius excubitor
Procyon lotor
Felis silvestris
Canis lupus familiaris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

See Bennett (1990) for information on the ecological relationship between the house sparrow and house finch in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

House Sparrows use a set of postures and behaviors to communicate with others of their species. House Sparrows also have a set of vocalizations that are used to attract mates, deter intruders, and warn others.

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

"The House-Sparrow is a confirmed hanger-on of Man in hills and plains alike, whether in bustling, noisy city or outlying forest village. When fresh areas are colonised, the Sparrow is amongst the foremost to profit, and quick to adapt itself to the new surroundings. In spite of this, however, its complete absence in certain apparently suitable localities—as for example in the Travancore hills -- seems curious and inexplicable. In winter, House-Sparrows collect in flocks—often of considerable size — to feed in the neighbourhood of cultivation. At this season, too, large numbers roost together in favourite trees or hedges, and indulge in a great deal of noise and bickering before settling down for the night. Their food consists mostly of grains and seeds gleaned on the ground, or picked out of horse -and cattle-droppings. Indeed, the presence or absence of horses at a hill-station, for example, has a marked influence on the local sparrow population. Insects and flower buds are also eaten. The vulgar, irritating call notes of the Sparrow are too well known to need description. Breeding males have, besides, a loud monotonous, and still more aggravating ' song ' — Tsi, tsi, tsi or cheer, cheer, cheer, etc, uttered, sometimes for fully 10 minutes on end, as the bird fluffs out its plumage, arches its rump, droops its wings and struts about arrogantly, twitching its slightly cocked tail"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

House Sparrows use a set of postures and behaviors to communicate with others of their species. House Sparrows also have a set of vocalizations that are used to attract mates, deter intruders, and warn others.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

A wild House Sparrow lived to be 13 years and 4 months old, though most will live for only several years.

Range lifespan

Status: wild:
13.0 (high) years.

Average lifespan

Status: wild:
189 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

A wild House Sparrow lived to be 13 years and 4 months old, though most will live for only several years.

Range lifespan

Status: wild:
13.0 (high) years.

Average lifespan

Status: wild:
189 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating System: monogamous

House Sparrows form monogamous pairs for each breeding season. Nests are built between February and May. House Sparrows nest in crevices inside and on buildings, and in coniferous and deciduous trees. Nests are built from dried vegetation, feathers, strings, and paper. Eggs are layed at any time in the nesting period. One to eight eggs can be present in a clutch, with the possiblity of four clutches per nesting season. Incubation begins after all the eggs have been layed. Both males and females incubate the eggs for short periods of a few minutes each. Incubation lasts for 10 to 14 days. After the eggs are hatched, both males and females feed the young through regurgitation.

Breeding season: February through August in North America

Range eggs per season: 1.0 to 8.0.

Average eggs per season: 5.0.

Range time to hatching: 11.0 (high) days.

Average fledging age: 14.0 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 5.

Both males and females incubate eggs and brood young until they have fledged. Both parents also provide their young with food.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In North America, breeding begins earlier in the south than in the north. Clutch size generally averages near 4 in the southern U.S., near 5 in the northern U.S. and southern Canada. In the northern U.S., most females produce 2-3 broods per year; generally clutch initiation occurs about 4-7 days after fledging of a brood, though quicker renesting sometimes occurs. Incubation averages 12 days, mostly by female. Young are tended by both parents, leave nest at an average age of 14-17 days. In various areas of North America, hatching success was 50-83%, fledging success was 53-78%, and nesting success was 31-71% (see Anderson 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Practically throughout the year. Several broods are raised in quick succession. The nest is a collection of straw and rubbish placed in a hole in wall or ceiling, niche, gargoyle, inverted lamp shade, and in every conceivable situation within or on the outside of a tenanted building. Rarely, in some small bushy tree or creeper. The eggs—three to five—are whitish or pale greenishwhite, marked with various shades of brown. Both sexes build and tend the young, but the female alone incubates. The incubation period is 14 days. '36"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: monogamous

House Sparrows form monogamous pairs for each breeding season. Nests are built between February and May. House Sparrows nest in crevices inside and on buildings, and in coniferous and deciduous trees. Nests are built from dried vegetation, feathers, strings, and paper. Eggs are layed at any time in the nesting period. One to eight eggs can be present in a clutch, though there are usually 5, with the possiblity of four clutches per nesting season. Both males and females incubate the eggs for short periods of a few minutes each. Incubation lasts for 10 to 14 days. After the eggs are hatched, both males and females feed the young through regurgitation.

Breeding season: February through August in North America

Range eggs per season: 1.0 to 8.0.

Average eggs per season: 5.0.

Range time to hatching: 11.0 (high) days.

Average fledging age: 14.0 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); oviparous

Average eggs per season: 5.

Both males and females incubate eggs and brood young until they have fledged. Both parents also provide their young with food.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Nests are parasite-free: house sparrow
 

The nests of house sparrows are kept free of parasitic insects by a lining of leaves from the neem tree, containing insect-repelling compounds.

   
  "During an outbreak of malaria in Calcutta during 1998, Dr. Dushim Sengupta and fellow scientists at Calcutta's Center for Nature Conservation and Human Survival were surprised to witness house sparrows lining their nests with (and also eating) leaves from the paradise flower tree (Caesalpina pulcherrima), a species whose leaves are rich in the anti-malarial drug quinine. Confirming that their choice of leaves was deliberate, the sparrows swiftly gathered fresh leaves of this same species when the scientists removed those already lining their nests. Moreover, before the malaria outbreak, these birds has been using leaves from the neem tree (Azadirachta indica) for nest lining. These contain high concentrations of insect-repellent compounds, which are of great benefit to birds rearing nestlings, who are vulnerable to diseases spread by insects and to nest-dwelling parasitic insects." (Shuker 2001:216-218)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Self-medicating to prevent malaria: house sparrows
 

House sparrows protect themselves from malaria by lining their nests with and eating quinine-containing leaves from the paradise flower tree.

   
  "During an outbreak of malaria in Calcutta during 1998, Dr. Dushim Sengupta and fellow scientists at Calcutta's Center for Nature Conservation and Human Survival were surprised to witness house sparrows lining their nests with (and also eating) leaves from the paradise flower tree (Caesalpina pulcherrima), a species whose leaves are rich in the anti-malarial drug quinine. Confirming that their choice of leaves was deliberate, the sparrows swiftly gathered fresh leaves of this same species when the scientists removed those already lining their nests." (Shuker 2001:216-217)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Passer domesticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCTCCAACCCACAAAGACATTGGCACCCTGTACCTAATTTTTGGCGCATGAGCCGGGATAGTAGGTACCGCCCTAAGCTTACTTATCCGAGCAGAACTTGGACAACCAGGGGCTCTCCTAGGAGATGACCAAGTTTACAACGTAGTTGTCACAGCCCATGCTTTCGTGATAATCTTCTTCATAGTTATGCCAATTATAATTGGGGGATTCGGAAACTGACTAGTCCCACTGATAATTGGAGCACCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTGCTACCCCCATCCTTCCTCCTGCTACTAGCATCCTCCACCGTAGAAGCGGGGGCCGGCACCGGATGAACAGTATACCCCCCTCTAGCCGGCAACCTGGCCCACGCCGGAGCCTCAGTAGACCTAGCAATCTTCTCCCTGCACTTAGCAGGTATTTCTTCAATCTTAGGGGCAATCAACTTTATTACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACACCCCTATTCGTCTGATCAGTACTAATCACCGCAGTGCTACTGCTCCTATCGCTACCAGTTCTTGCTGCAGGAATTACAATGCTACTCACCGACCGCAACCTCAACACCACATTCTTCGACCCCGCAGGAGGAGGAGATCCAGTCCTATACCAACATCTTTTCTGATTCTTCGGCCATCCAGAAGTCTACATCCTAAATCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Passer domesticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 35
Specimens with Barcodes: 59
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2014
    Least Concern (LC)
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5