Vombatus ursinus (Shaw, 1800)

Forest Wombat


Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: Least Concern (LC) external link Showing: scientific names

Media Center Navigation


Vombatus ursinus (Shaw, 1800)

Images


Choose images

Vombatus ursinus (Shaw, 1800)
Vombatus ursinus (Shaw, 1800)
Vombatus ursinus (Shaw, 1800)
Vombatus ursinus (Shaw, 1800)
Vombatus ursinus (Shaw, 1800)
Vombatus ursinus (Shaw, 1800)
Vombatus ursinus (Shaw, 1800)
Vombatus ursinus (Shaw, 1800)
Vombatus ursinus (Shaw, 1800)

Page navigation

Page 1 Next





Classification : Text | Graphic |

Barcode

Barcode data

Source and Additional Information
Location
Citation

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 

GBMA0092-06|AJ304826|Vombatus ursinus|

AACCGTTGATTATTCTCAACTAACCACAAAGATATTGGCACCCTGTACCTCTTATTCGGTGCCTGAGCAGGAATAGTAGGGACAGCCCTA---AGCCTATTAATTCGAGCAGAATTAGGCCAACCTGGAACCCTCATTGGTGAT---GACCAAATCTATAATGTCATTGTAAGTGCTCACGCTTTTGTAATAATCTTCTTCATAGTTATGCCTATTATAATTGGAGGCTTCGGTAATTGACTAGTCCCTCTGATA---ATCGGCGCCCCTGACATAGCATTTCCACGAATAAATAATATAAGTTTCTGGTTACTCCCACCCTCATTCCTCCTCCTACTAGCATCCTCAACAGTAGAAGCGGGGGCAGGAACAGGATGAACTGTATACCCTCCATTAGCTGGAAATATAGCTCATGCTGGCGCATCCGTAGACCTA---GCTATTTTGTCCCTACACTTGGCAGGCATTTCCTCAATCCTAGGGGCTATCAACTTTATTACTACCATTATTAACATAAAACCCCCAGCCTTATCCCAATACCAAACTCCCCTATTTGTCTGATCTGTCATAATCACAGCAGTTTTACTCCTTCTATCACTTCCAGTACTAGCCGCA---GGTATTACTATACTACTAACAGACCGTAACCTAAACACTACATTCTTTGACCCAGCCGGAGGGGCGGACCCTATCTTATACCAACACTTATTCTGATTTTTTGGCCACCCAGAAGTTTATATTCTCATTCTCCCAGGCTTCGGCATAATTTCACATATCGTAACATACTATTCAGGTAAAAAA---GAACCATTTGGCTATATAGGAATAGTATGAGCTATGATATCTATTGGCTTCCTAGGCTTTATTGTATGAGCCCATCATATATTCACAGTAGGACTAG


 
-- end --
 


Download FASTA File
Paddy Patterson. Curator. "Vombatus ursinus (Shaw, 1800)". Encyclopedia of Life, available from "http://www.eol.org/pages/981577". Accessed 21 Mar 2010.